Description :
From Genome Similarity Track
Location :
Scaffold_4:416700- 419666
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002042Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
2966 bases(100 bases per row)
TGCACAAGCGTGTGTGCCGTGTATTGGGAACTGTTGTGAACAGCGTCCCATTACACCTGGTAGCACTTCGAGCGGTCCTTCCAACGACCCAGTGAAGTGA
AAGGTTTGACGACGCGGCTTTAAGCACGTCGCGCATTCCTGTTCAAGACCTACTCTTACCCATGTCCGGGAACATGGAAGGAGTTGATGTGCCACTCGGT
TCAGCAGTACCGCAAACTGTCGAGTTGACGAATGAGTATTTTCCTCATTTGTCTTCTCATGAGTGGTCAGCGCTGGAGCGGATGAGAGATGTCATCGGGG
AGGCTGCTGTGGTCAGCCTGCTTCGATCGGCATCCCCTGAAGACCAAAAGAGCGCTGCGGTCAGTTTCATGCACCACGAGATTGTTGAATCTCGAAAGCA
GGTCGCAACCCCTGTTTCGTCCTTCAAGACGGTGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGGCGGAGAGAACGAGCCTCTTTCGAGATGGTTCGTT
GAGTTGGATGCAGCAATGTCTGCAAGACAACTCCGCGACCCCTCGCAGCAAGTGTTGTTCGCAATGTCCAACCTTGCGGGTCGTGCGAAGAGCTGGGCTT
ATGGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATGGCGTTTGAACCACCGCAGAGTGAGTTCCGTGC
ACGCGCCGAGTTTCTCAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTTATCTGGTCTCGAGCATGTGGACGAGCCGATTG
ACGTCCCAACGCAAGTGTGACGTCATGACGGGTCTGAACGACGGTCCATCCGGAACCAATTGTTCCGTGAGTACCCAAAGACCCTTGAAGAAGCCATCAG
CCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAAGGCAATCGAACGTCGTTCATGATGGTCCAGAG
CCAATCGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCGTTGTGGGAAGTCGGGTCACTTCGCTCGAAACT
GCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCACGCTCGAACAACTACGGCCGTAGTAATGGTCGTCGGTTCGATCGTTCCCAAAGGTCAAA
AAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGGAAACACAGGACTCTGGCCCCAATGTGCATGATG
CACATGCAGTTTCCACGAGTGAGAGCAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCTCTACGTGCTTT
AGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACATCTCTGTGCCTGTTGCGAATGAAGAGAAGATGATGATTGTT
CGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAGTATGAAGATTTCCGAGGTGAAGACGAGTTCATTTTACTCG
ACCTCGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAAGATGAAGATCTCCGTTGACAAGTC
GTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGTGGAAGAAGTCCCAGATGGCCCTTGTGATATTGCGGTGTGC
GATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGATGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTCTCCTTTGCCATCGACG
ACAAAGTTGCGTGCGATGGTAGTGTGAAGAACGACGGGAAAAGAGGCAGAGACCCATCCCAAGACAAGAAGAAGAAGACCAGCGAGAAGAGTGTTCCGTC
AAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCACAAGACATTTCAAGCGAGTTTGTGAACGTTCTGGTCTCG
AACGAAGATGGTGACGTCGATGTAATCCATCACATGAAGATTGAAAATCCCCCAAGTTCAGTCGAAGAATTGATTTCCTTGCCATGGATGAGCAAGAAGA
CGCTGAAGCGTAGCCTAACGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGACGATGCAGAGGACATCGGCACGGTATCAGCAACGGAAGC
TGAAGTGCTCGATGAAAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCGTGGGATGCTCTCAAGATGAACCCCGTGTATGCACTTGCCAGGGAATTTGAA
GACATTTTCCCAGACAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCACGAGATTGACATACTTCCTGGCACGAAGTACTGTATCACACGAC
AGTGGCCGTTGCCAAAGGAACAAGTCGAGGCAATTGACGAGTTCTTTGCGCAACGCGCGAAGGCTGGGCATGTGCGGGAGAGCAAGTCTCCGCATTGTAG
TCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACTATTCCTGCTCAGACTCCGGTTCCA
CGCAAGGATATGATCCTTGATGGGATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCGCAAAGACGATG
TCCCACTAACTGCAGTGAGTACCCCTAGTGGTATGCTGCGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCACCCGCGACCTTCAATCGAATGGT
CACGAACGTTCTTCGTCCTTTACGAACATTTGCACCGAGTTACTTCGACGATATCTTCGTTCATAG