Description :
From Genome Similarity Track
Location :
Scaffold_4:416689- 420258
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002042Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
3569 bases(100 bases per row)
CGCTTCCTCGTTGCACAAGCGTGTGTGCCGTGTATTGGGAACTGTTGTGAACAGCGTCCCATTACACCTGGTAGCACTTCGAGCGGTCCTTCCAACGACC
CAGTGAAGTGAAAGGTTTGACGACGCGGCTTTAAGCACGTCGCGCATTCCTGTTCAAGACCTACTCTTACCCATGTCCGGGAACATGGAAGGAGTTGATG
TGCCACTCGGTTCAGCAGTACCGCAAACTGTCGAGTTGACGAATGAGTATTTTCCTCATTTGTCTTCTCATGAGTGGTCAGCGCTGGAGCGGATGAGAGA
TGTCATCGGGGAGGCTGCTGTGGTCAGCCTGCTTCGATCGGCATCCCCTGAAGACCAAAAGAGCGCTGCGGTCAGTTTCATGCACCACGAGATTGTTGAA
TCTCGAAAGCAGGTCGCAACCCCTGTTTCGTCCTTCAAGACGGTGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGGCGGAGAGAACGAGCCTCTTTCGA
GATGGTTCGTTGAGTTGGATGCAGCAATGTCTGCAAGACAACTCCGCGACCCCTCGCAGCAAGTGTTGTTCGCAATGTCCAACCTTGCGGGTCGTGCGAA
GAGCTGGGCTTATGGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATGGCGTTTGAACCACCGCAGAGT
GAGTTCCGTGCACGCGCCGAGTTTCTCAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTTATCTGGTCTCGAGCATGTGGA
CGAGCCGATTGACGTCCCAACGCAAGTGTGACGTCATGACGGGTCTGAACGACGGTCCATCCGGAACCAATTGTTCCGTGAGTACCCAAAGACCCTTGAA
GAAGCCATCAGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAAGGCAATCGAACGTCGTTCATG
ATGGTCCAGAGCCAATCGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCGTTGTGGGAAGTCGGGTCACTT
CGCTCGAAACTGCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCACGCTCGAACAACTACGGCCGTAGTAATGGTCGTCGGTTCGATCGTTCC
CAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGGAAACACAGGACTCTGGCCCCAA
TGTGCATGATGCACATGCAGTTTCCACGAGTGAGAGCAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCT
CTACGTGCTTTAGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACATCTCTGTGCCTGTTGCGAATGAAGAGAAGA
TGATGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAGTATGAAGATTTCCGAGGTGAAGACGAGTT
CATTTTACTCGACCTCGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAAGATGAAGATCTCC
GTTGACAAGTCGTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGTGGAAGAAGTCCCAGATGGCCCTTGTGATA
TTGCGGTGTGCGATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGATGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTCTCCTT
TGCCATCGACGACAAAGTTGCGTGCGATGGTAGTGTGAAGAACGACGGGAAAAGAGGCAGAGACCCATCCCAAGACAAGAAGAAGAAGACCAGCGAGAAG
AGTGTTCCGTCAAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCACAAGACATTTCAAGCGAGTTTGTGAACG
TTCTGGTCTCGAACGAAGATGGTGACGTCGATGTAATCCATCACATGAAGATTGAAAATCCCCCAAGTTCAGTCGAAGAATTGATTTCCTTGCCATGGAT
GAGCAAGAAGACGCTGAAGCGTAGCCTAACGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGACGATGCAGAGGACATCGGCACGGTATCA
GCAACGGAAGCTGAAGTGCTCGATGAAAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCGTGGGATGCTCTCAAGATGAACCCCGTGTATGCACTTGCCA
GGGAATTTGAAGACATTTTCCCAGACAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCACGAGATTGACATACTTCCTGGCACGAAGTACTG
TATCACACGACAGTGGCCGTTGCCAAAGGAACAAGTCGAGGCAATTGACGAGTTCTTTGCGCAACGCGCGAAGGCTGGGCATGTGCGGGAGAGCAAGTCT
CCGCATTGTAGTCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACTATTCCTGCTCAGA
CTCCGGTTCCACGCAAGGATATGATCCTTGATGGGATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCG
CAAAGACGATGTCCCACTAACTGCAGTGAGTACCCCTAGTGGTATGCTGCGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCACCCGCGACCTTC
AATCGAATGGTCACGAACGTTCTTCGTCCTTTACGAACATTTGCACCGAGTTACTTCGACGATATCTTCGTTCATAGTAAGGCACAAATGGGAGATCTGA
TGTCGATGTTCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAGT