Description :
From Genome Similarity Track
Location :
Scaffold_143:41641- 45155
Transcript NameFunction/comments
Hyaar_Emoy2810991cysteine protease family C26 putative

Sequence
3514 bases(100 bases per row)
ATGCTCGAGTTCCCGTTGCACGATGGCTTTTTCCCTCAAATCGCCCTCTCACGTGAAGAAGTCAAGTACTATAAACGACTGGGGAAAGAACGCGTAACAC
AATTAATTCGGATCATCGAGGACGCCGACTGTGCGTACAAATGGACAAGTGCCACCAGGGATCGTCGCAGTCACCGGTCGCGGCTTCCTGGACGGTCCCG
TCTTAGTTTCGAGTCAAAAGACGACGTGGCTATTGTGTGTGAACGGGCAAACTTTCTCGACTTTCAGCCCACGAACAAATCGGCTCAGGCGTCCACGTTA
CTGAAAGCCAGTGTCCAAGTCTCGGATATCCAAGTGGACGAGATTTTACGTGCGGTGGCGAAAGTCAAGACGAAAGAGTTCCGGAAAACCATGCGGTATA
TGCACGATGACGGTTTCGTTGATGGCCGGACGTTGTTTACTTTTCCGAGGGAAAGTGTCCGACCAGCTAAAAATAGCGCAGGGCGAGCGGTCTCGTCGTC
GTCGTCGTCCTGTTTTTCTTATCGTGCAATTAAATGGCACGCATTGAAAACCCAGCGACGTCGACATGGCGAAGAGGAGAAAAAAGTGGATTTTTGCTTC
TTAGAGTACGCGGGTAAGAAAAAACCTCATCCCGGCTCGAACGTTGTGGGCTTCTGTATCCAGGAATCGATCTCGCGGGATCGAGAAGTCCCGACCTTGG
AGAATTTCGGGATCGCTCGTGGCTATTTATCAAGAATGGGCATCATTATCTCAAAAACGCATCAGGCGAATACGTTCAAAGTGACGGCTATTTGTCAGAT
TGATGGAGACTTGAACCCCATTGTTCGCAGTGTGCTGGAGGAATTAATGGAGAAAACTGTTGGTGCTGTCGCTAGAATTCCAGGCCTTGTAGCTCGACAG
CGAGTGAGCAGTTTGAGGTTTGTCGAGCAGTGGCAATGGGTCCCGAATTCGGATCGAAAAGCTTGTGCCGTTTGTCTTCGGGGCTTTTACTTTCGTCGAA
AGCACCATTGTCGAACGTGTGGAGAAGTTGTTTGTTCATCGTGTGCGTTGCTTCGAGAGCTGGAAGAACCCATCTTTGATATAACGCATTTGCGGGTTTG
TTCGGCCTGTATGACAAGTGCAGGTGCAAGGCAACAAGAACAGCAATGTTCAGCACAAAGTAATACGGGAACAGGTGACGAGCCACCGGTATCGGGGACT
TCGAACGACACCGAGTCGTACATTCGTGGCTTACGTAGCCCGCAACACAATTCATATGAAGACATGGTTTTCCATATGCGGGAATCACGAGATCGTGACC
GTCGACAGAGTGACCTGGCTGGTGATGTCCTCGAGACCGATACGGAGCTCAAGCCAGCAAGTCCTCTGCGAAACCTTACGGTGAGTCCAGAAAAATTGCG
TGCACAAGACAAGATACAAGCTCTCACGGAAGTTGTCACGCGGATTCGTGAAGTGCGTGATACGATCAATCTCTCCATGTCGGAAGCAGCATATGGACAA
CATCAAGACGAGGAAAACAGCGAGGAAATTGAGGAATTCAACGACATGTACAGCGAGATTACATACATCCAAGAGGCACTTGAAAGCTCCGTGTTAAATT
ATGATGCAGCACTGGCCAACGCGACGAATGCTGCACCTGCCATGTATTACTCTGGACCGAGTACTCGTAGCCAAGAAGATGGTGGTATCAGTGAACCTGA
CGAAGACGATGGAATGACGGCCAACCAGTTCGAGTCTGTTGCACGCATTACATTTGCCGCAGCTCGAGCTACAAAAGAGGCTGGTCAAGCCTTTTTGTCC
GTTGGAGAGCGCCAACATGTGCAACATGATTATCGCTACGGTAAAACGACTCACTTGGAACTCGACGACGATGTATCAGCCAGTTCGGCTTCTGTAGCAA
GCTATCCGACATTAACCGGCAGCTATAACAGCTCAGGTCAAAGCATCGACCCGTATTCAGCATCGAACTACGAAAAAATCATGGCAAATTATCAGCCAGA
GCAAGATGGTTCCGAGCATGATTACGAAGACGATAGGCACTCCTCGTATAACTTTGCTGACTCGGTTCGCCGTGTGACCGAAATCCATGAGCTGGAAAAG
AAGATCCTGGATTTGCAGCGTAGCCTGGAGGAAGCTCAACACAAGCTGTCTGTCATTGATAGCGATGAACCAGAACCTGAAGTACGCTTACGCCAGCGAC
TCGATGCTGCACGTGATCGTTCAGCGCAACTTGAGCTTGACAGCGTCTTTGAGATTTTTGGGGAACAGGGAGACGGCAAAGGAGCTACAATTTTAGGCGA
AACAGCGTCTTCTGAGTCACTAAGCGACACTGGCATGTCTTCACCGACGAAAACGATAAGGTCGAGAGGTCTTACGACGCAAGACTTGGTGTCCGAGCTA
CGGGGTGTGATGGCTTCCATTGATACTCCTGTTCGTGATAGTTCTGAACCACGGAAGTCGGTATTGAGACCATCGATTCATCAAATGCCTTCAAGTGTTG
ACAAGAGTTCAATGAGTTCCCGAATGCTGCCACCTGTAATGGCCTCTCCGCTTGCTATTAGCATGAATCCGTCGTCTCAACCAGCCAGTATTTATTATTC
AGCACACCCTATGCCATCGAAGCCGAAAGGAGGAAGACCAGTCAACAGTGATCTGAACATCAGTCGTGGCAGCATCAAGAAACACCATTACGGACACTTA
TCTGGATCGAACCGACCTTCGGCAGCACCAACCGAAGGGTCCTACTTACAAGCTCTTGGCACAACTTGTGGGACCCGATGCGGTGGTGACAATGACGATG
ATAATGATCATGATGATGATGAATTTGCTTCCTTATCGTCGGACGAAGAGAGCTACAATGACTCTTATGACGAGATGTCGATGTTCGGCAGTGATGATTT
CAGGGAAGCTCAGTTGAGGAAGTACCATAATGGTTCCGATCCCTTCTTCATTGAGGAGGATTTGGGTGCTCTGCTCAAGTTGCGAAAAGCAGCAGAAGCG
GAAGCGTCACCGCCAAATGACCTCGCTACATCGCCCTATTCGCCCTCATCACTTGATCCCGCAATGGAAATGGATGAGCGCAACGATCTTCGACATTTGA
TGGCAGGTCTTGTCCGTCGACGTAGTTGTTCGTTGCCATTTCCATCCGGTCAAATGGGTGGTGCTTCATCCGGTGAATTCCTCCATGATAAACCGTCGTG
GAGTGATGACGCGCCGGATCGTGTCCCAACAGTCCACCAAGTAAAAGAAGCTCTTCACGAAGTCCGGGCGTGTCTAGCAAGTTGTCGCTGCGAGTGTCCA
TCCGATACAGATCGGACACGAAAACTCACCTCGATTTTCAAGGTGCTTGGCTCCTTGCATCGTGAAGGTGTGCGGTCGAAATTCCGGACTCTTCAGCACG
ATGACATTCGCTATTCGAAAATGATGCAGACCACACCCAGCATTATTAAGCTCCTCAAGCTCGCTGGGTACGTCTCGCTTCAACAAAAGCTCACCATGCG
ACGTGTGGATCAGG