Description :
From Genome Similarity Track
Location :
Scaffold_89:41640- 43326
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_89-abinit-gene-0.85Protoporphyrinogen oxidase

Sequence
1686 bases(100 bases per row)
GGCCGCGCGCGAGGTGGTGGTGCTCGGCGGGGGCATCTCCGGCCTGAGCCTTGCCTTCTTCCTGCGCCAGGCGCTACAGCAACTCCCGTCCACCCTGACG
ACCGCGGTCCCGACGCGCATCCGCGTGCTGGACGCGGCGCCGTCCGCCGGCGGGTGGGTGCGCACGGCGAAGAAAGATGGTTTCCTGTTCGAAGAAGGCC
CGCGCGGCTTCCGTCCGTCTCGTAACGGGGCCGAGATGTTGCGGCTGGTGGAGCAGCTCGGACTCGAGCAAGAGATGGCGGCCGTCGACCCGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCGCAACGGCCAGGTCGAGGTGAGAGAGATAGTCGATACTCTGGTGTGCTCTATCCATGCTCGACTAATGC
GTTCGGTTTTGCTCAATGGGAGTAGAAAGTCCCAACGTCATTGCTCGAGGCGCTGCGATGGCCACTCGCAGGTCAGGTCGTCCAGGCAGGGCTGCACGAG
CTCTTCGCCAAGCGCGGGACGGTATGTACAGTCGGTAGCCACACCACTGCAATGCTTGTGGGATGGACAATGACGAAGGTATTGGATCAATGACAGCTTG
ACGACGAGTCCATCTACGACTTCACTGCGCGGCGGTTCAGCCCAGTGATTGCCGAGCGACTACTGGACCCCATGGCGTCGGGTATCTTTGGGGGCGACAT
CCGCTATCTGTCGATGCGTGCATGCTTCCCGATGCTGGTCGACCTGGAGCAGCGTCACGGCTCGGTCGTGCGCGGCATGCTCTTTGGCGGCAGCAAGGAC
GACAAGCTGCTGGACGGCACTCCCAAGTCCGAATTCGTCCGCCAGCACGAGAGATCTGTCAGCATCAGCTTCCGCGACGGCATGTCGACGCTGATGAACG
CCATGGAGAAGCACATTCGGGTGAGGTTTCGAGGTAGATTGGAGTATGGCCGACTCAGCGTAGACTAATGATGTGCCCTTGATTCGTCACAGGCCGACGC
TCTGTCCGAAGTGCATGCTAATGCAAAGGTCACGCGCATCGATCCGACTTCTTCGCAAGATCGGACGTCATTCGTGGTGACGACAGAGGATGCTGCGACC
GGCCAGTCCGAGCAAGTGGAGGCGACTCACGTGTTCTCGACCATTCCCGCCTGCTACCTGGCGCCAGCCGTGCGTGGCGCGCTGCCCAAACTCGCTTCGG
CGCTCGACGAGATCAAGTTTGTCGACATGGCGATGGTGCACGTGGGGTTCAACGCGCGCGTCCTCGCGAGTGACGGCTTTGGCTACCTGGTGCCGACGGC
CGAGCGCGAGCGCGTGCTCGGAGTCGTGTTCGACTCCAACACTTTCCCAGTCCAGAACGCGTCCGACAATGACGAACAGACCCGAGTGACTGTCATGAGC
GGCGGCGCTCACTTGCCCAATGTGCGGTCGATCCCCTCCGAAGAGCTCGAGGCCACAGCAGTGGATGCGCTGCGCCGCCACTTGGGCATCGAGCGCAAAC
CCGATTTTGCGCGCGTGCTGACGATGCAGAACGCGATTCCGCAGTACCATGTCGGGTTCGCGAAGACGTTGGGCCGCATCGAGCAGGAAGCCGTGCCTGG
GCTGTACCTGGGAGGCAACAGTTTCTACGGCATCGGCCTCGCGGACTGTGTTACTCGCTCCAAGGAGCTCGCACTGAAGTTCGCCA