Description :
From Genome Similarity Track
Location :
Scaffold_216:4161- 5317
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_216-abinit-gene-0.21Dynein heavy chain

Sequence
1156 bases(100 bases per row)
GAAATATGGCTCTTTGCTTACAGAAGTCCGCGCATCGCTCTCCGGAGGCATGTACACAAATGTGTCGACATCGTTCAAGTTCCACTCGGTCACAGCGGCG
CCAAAGACACTGGCATTTGGCCCGTGTTTGATCTCGTCACTGAACGATAACTGCTTGGCGGAATTCCCGACAGCGTTTATCATCCAGTCGAGAGACAAAG
ATGACAACCCGCGTGATTGCGGCGGAGACGAATTTACGATCGTGCTCAAGTCATGCGATGAGCCAAGCAAACCAGCGACATCGGAAGCTGAGGATCCTCC
AATCACGAGCATCATTGACAAAAATGACGGCACGTATGTTGTCACGTTTGCTGCCCCTAAAGCTGGCAAATATCAGCTCTCCGTGGAATTCAACGGAACC
TTTGCCGGCACTGCAGGTCCCGTGCGGGGGTCTCCGTTCACGATTTTCTTTCAGCAACCGACTGAAGAGAACAAAGCTCGCTGCATGCCACCGCTTAATA
GCGAGAAAGACATGGACTCGTCTGATCTCATCCGTCGTCTCATGGCGAATATGAACAAACGCAATGGTGAATTTCGCCGCATTCTCATTGATTTACGGAA
AGATATCCCGAGTAATGAGACCGACGGCCTCGAGACATTACGAAAGGTGAAGGAAATTATCCGAAAGTTAGAATTGGAGAAAGAAATCAATCATTTGATA
CTTGACCAAGTGCGCCAACTTTTTGGAAACATCAAGAAAATTGGTGGACATGTCGACAAAGAGCTTGTCGAGATTGAGAACATGGAAAAGCTCTTCTTGG
ACGTGCAGAAGCAGATACCAACGACTGAGCAACGCACGCAAGAGCCGACCCGCATTTTCAGCGAGAAGACTGAGGAGAAAATCATCGCTTACGAGAAAAC
GATCATCAAGAAGATGGAGACGATGAAAACACTCGATTTTTGGTCCTCAAAACTCGATCCGGAGAAAGGATTGGAGAAAATCGAAAGCTACTTGGTGGAT
TGGGAGATGGAGATGAAGAAATGTGAAGAAAACACCAAACTGTGCTCGATTTTTGGCTTCCCTCAGCTCATGAACGAGTCCTTACGCGTCATGGATCTCA
TGCGCGCTGATGCTGAAGGGATGAAAACCGTGTGGGCGATTATCAAGCGAGCGAAA