Description :
From Genome Similarity Track
Location :
Scaffold_80:416- 8059
Transcript NameFunction/comments
Phyta_totarag3095hypothetical protein PHYSODRAFT_353499
Phyta_totarag3096conserved hypothetical protein
Phyta_totarag3097hypothetical protein
Phyta_totarag3098conserved hypothetical protein
Phyta_totarag3099cysteine protease family C01A, putative
Phyta_totarag3100cysteine protease family C01A, putative

Sequence
7643 bases(100 bases per row)
GCCCGTGCGATTGAGCTACGATAAGAACGTGCCGTTGAGCTGTAGATCTCCGCCCgccacttgagcagcagacTGTCCAAGCCAATTCATATAGCAAAGC
GCTTCTAGCAGCAAACTACCAAGCTTCCATATTTTCTGGTTCGGTCAACCATCCCGCTCAGCCTCGTCACAACTGCCCCGCGGACGCAACGTCAAGCGAG
CTGACCCAAGCGGCTCCGTTCAGCGTCGCCCGGACATACGCGCTCTCTGACTCTGGCCTCGAACGCAGTTAGTACCGCCAGCCAGCGAGGCCACCTAGCC
GAGCTGCCAAGTCGGCTAAACGACAGCAAGGCGGAAATAAAGAAAGAAACGCCAGGCAACGGGCGAGGAAAGGCGCGGCAAGCCCGCTGGAATACCGGCA
GAAGGCACGGCTGCACAAAGCAATCTCGGGTGAATAAGCCAACAGCAAGACGAGAGCTTGCTTGGCGTGGAGGGCACTCACTCACTTGTCAATTGACCGC
GATCTCCTTTGATTCTGCTTCGTCCGTCTGTCCTAGCAGTATGGCGCAACGGGAGCTGTCTTCACTCATGGCAAATGTGACCGGGTACACGGAGGCTCAG
CTCGTGGTGCTAGTGCTGagcgtcgtggtggtggcagtggCGCTGCTCTCCTACTTCGTGGTGGCGCCCGAGTACGAGAAACACCTGGACAAACAGTACG
CGGCGCTGGTACATGCCTCTTCGGAACGGCAGCTTCTGAACCAACAGGCGCATGAATTGCTACTCGCGCGGATCCAGCTCCGCAAGCACAAATCGCTTGG
CGCCTGGGACATCGAGTCCggctccagcgacgacgacgggcTGGGTCACTGCACgctacagcgacgacactCGCACATGCGACCGCCTCCAGCCAGCGTC
TCTTCGCCTCGGGACTTGATCACCGAGGCGGCACTGATCGCCCGCAGAGAACGCAACGCCCGTCGCCgcaagagcgagagcgacgcgCTCAAGCAAGCCA
CCATCCAGCGAGCAGAcatgctgcgtcgtcgagtgCTACTGCggaagctggaggaagaaaTCGCTGGCACGGTGAAGGCGAACgaggaagctcaagctgc
gaCGACGGGCAGCGCCAATCCGAGGTTGGCGAACATGGCGAGCAACTCGCTGGATCTGAGCAACGACCGCCTCAAaatgctgcaggagcacCCAGCAGAC
TGCGTCGAGGAGCTCACGGTTCTTGCCCGAGCACAATCACCGACAGCAGCCTCGCCTCTTGTGGACAATGCAGCCAGGATGATCAAGGGCAAGATCGAGA
CTGCACCAGACCTCCACGAAGTAAAGCGAGcgctcaaggtgctgcacgacgtgcTGAGCTTCTACTTATCGGTGGACCACCGAGATATGAACAAGCTCAC
GGTGTTCtgcaactcgctgctgcagcacgacggcCTCAATCGACTACGCGCCTTTGAGGCATCACGCGACAAGGACGTGCGAGTGCTGTCCAACTCCATC
ATCGAGAAGGCTGTGCCTGCCATTTGGCATTAAAAGAGAACAACCATATATCTATAACCCCCCGCTTCCGGCCCCTGTAGAGCTCCTCACCTCAACCAGC
AAGTACAGTAAATTCTAGTAGCGCATTCTTAAACATAATAACTAGTGTCCCCTTTTGTAAGTTCCTTTTCAGCTCCAAAATCATAGTCTCTTTCTCTTCA
TTAATGACTCATATTCCACTGGTAGTAGTCACCTATTTCTGTTGGAAAGACGCCGCAATTTCTtgcagcgagcgcgagaGCACCgtcctcagcagcagtc
ggGAGATGGACCCACCACAGAGCAGCACGCTGCCAAGTGTAGACGGCATGAGCTTGGAGTTCCACAGGATGAGCGTCTTGGGCTGCGAGGAGGGCGCCGT
ATTGTCGGCCACGAACTGCACGAATGCCACGTGATCGCTCAGTAGCAGCGGTCCGctcttcttgatgctgtAGCGCACACTGGAGATCCTGTCCGAGTGG
TCGGGCGGCCCCGCCGAGAGAATCTGCTCCTCGACGCCGAGCGAGacgaggcggcggtggccgaCGAGCCCGCGGCCTTCGCCAGGCTTCAGCGTCGACC
CGCGGCCGGCCCACTCCATGCGCAGCCACGCATCGTAAGCTTCGTCCACTGACGCGTTCACTAGTTgcgacagcgccagctcctgccCGTCGTTCTCCGC
GTACGCcttgaaggcggcggcgtccACGTACCGATCCGCCATGATGAGAAAATGGATCCGAATGAGCGAATACAGAACAAGGATTGGCTGAAATGGGTGA
AATGGGGATATGTGGTTGAAGTTAGCGTTTTATGACGAATTAAATGAAGCTGTTGAACGCTGTTTTGACGAATGAGGAGAAAGTATCTTTGAAACGGCTG
GAGGCACGCTTGATACACCAAAAGAGACGATATCAGTGACGTCAGTGGCTTCGACATTCGTTGTATTTGCAGATAAAGTGTCGCTCTAGTTCTACGCTTG
GCTCGTTATCCCAGGTGCCGACCAGCcttggctgcagcacttgcagccaGCGCGCTCAGGAAGCTCTGAAGCGCTGAGCGCAGGATGAACTTGGCGAGCC
CACCGCAGCAGAGTAGATAGCCGAGCACGCTGGGTTCCGTCTTCAGCGACCAGATCACGAGCGTCGCTGGCGTGCTCTCTGGGGACGCGGCGACGTCAAC
GAACTGCACGAACGCGAGGTGGTTTTGCATCGGGAACAGCCCGAACTTGCGGACCTTGTAGCAGATCGAGGGGATCTTGGAACGGTCCCGtcgggcagca
gcaagactCGGTCGCCCTCCGTCGCTGTCTACGGGCTCATCGATAGGCAACCCAGCTGACAGAATCTCCTCTTCAATGCCCAATGGGGCGCCCCGAACGT
GGCCGACGTAGCCTCGACCTACGCCCTCGTGCAACTCCGAGCCCCCGGCCAGCCAACCTTCCTCCAGCCACGCGTCGAACACCTGGGAGGGAGAGCCGAC
TACGCACTCGgacaccaccagctcctggCCCTTGTGGCGCTGGTATTCTTCGAAGGCCTGCGCGTCCACATATCGCGTCGAGTCCAATTGACTGCGGCGC
ATCTCCTTCGGCAACGCAGCGTTCTTGACACTGTTCAGCAAGATGGCCATCTTATTGTTTTTATCCGGATATTTGGCCAATAGAAAGGGCGCATAAGCTG
GAAATGCGACGGCAGCGTGGTTCCCTGTCATGCAATGCTGTTAGCACCACTGTTGCCTGATGAACACGTCACAATTGCTTGCAAGTGACCACTATATCGA
TGTTCTGGGGCTGGAGGCCTATGAGGGTCATGCTGGCGTGGAGCTTGAGGTATCGGAGCTTATAACAGGTTCGTCCCCCGAAGTATTCGATGCGTGGCTT
CGCGAGGTCTGGTTAGCTGGCGGGGATCAAGTGCACAAAGGCGTCGGTCGTGGATACGTTGGAAGTGTGCGTCGTGTACCGCTGggtgtggaggaggaga
tcgtgtCAGCAGGACAACCCGAAGAGCAATCAAAAGACCAGGGCGAGAGGTGCAGGATCCCATCGATCTGCTACCGAGTACGCAAACCTGGTCCATTCCC
GCTGGAAAGTCACCTAGCCATGGTGCGCTTTGTCGGTGCGGTATCAATCCCCGAGGTGTCAGCTAATTCGTTGAACAAGGCACCCAAAACGCTCGTGGTT
TGGACGGTGAAGACCGAGATGTCAAGAGCGTGCAACTGGCTGCACTGCGGAGGTTGGtccgcttcatcttctggGCAGCGTTGAAGACTTTCCTGCGGTC
GTTAGCCAAGCAAGCAGCCAGCAAATAGTTAAAGCTCAGATTGATGTCATCATGGCATTGTCGTCCCACTGCGACTTCAGCTAAGCTTAAGGATGATTGA
TCTATTGTTATTTTAACTTGGTACTTCGTACTTCGTGGACGTCCCAACTTGGGTGATTGATCGATCATATAATTTACAGAGTTTCCTTGAAAGCATTGCG
TTGACGACTGGCGTAGATGACACCAATCACCGTGAGGAATACCGTCGCAACGCCAACTGCAATGCCTAGGATAATCCAGCTATCAGGCGCCATTCCGACG
AACTCAACcgcgccaccaccatcgacCACCGTGCGTGCAGGGCCAGCTAACGCACCGGTCGGAATCACGGGGAAAACACTGAGCCCGCAATTGATCTTCG
AGTCGATGGCCAGGCGCAGAAAGCCCTTCTCTCCCCATGACGAGCCGTACGAGTTCTTGATAATCCAATAGTCTGTGGTGCCGTCCGAACCGTAGCCGAC
GAGTACGAGCGCGTGGTTGATATCGGCACTGGAAGCGAAGTCGCCATCATTCGGGCACGTGTAAATGCCGCCCTTGTATGCGTCAAAGGACCCACCAGAG
TTGATGGCCACGGAAAtgggctgttgctgcagtgccagCTTAAGTAACTCGGTCGAGTCACTGCTGTTCTCACACGAAGGCCCCACAACTTGCTCCCAAC
CAGCTatgctagcagcagcatcgtccgTTGACGAGTTGTCGCAAGCGTTCGCGAGAGTAGCGGCGGATGCTTGAGATGTATCCTCTTCGTTGTAGGGCAG
TTCCAGTTGACTAAGCAGCGACCAGTGCAATTGCGCTGCGTCGGTGAAGGCGGCGTGGGTCATGCCTCCGTTGCATCCGTTGTTCCTCGAGCCCCAGATC
ATTTTGCTTTGCAGCCAGCTCGATCCATCCACGCCGCCCTCTGCCCAGCAGTAGTCGAACGTAGCCGTCATCTCCCTCGAGCTGCACTCCAAGAATTGCT
GCGGTGACAGTGACTGCGGCGCTATTCCTGCATTTACCACGACCGCCGTCTCGATACTATCTGCCGCCGCAAAGGCCCAGCAGCTGCCACATTGGTTCTG
ACTCTTGACAACCGTGCAGATGCTCTGGTTGTGCGAGTTGTCGGTCGAGCACCAATCCAGCGTCTCGCGATATCCGAGTGTCGAGTTGGTGAGTCTTCGC
TGCTCTGTCAGTCTGCGTTCCTGTTGACGCTGCGCCGCTTGATGTTCATGCTGCACAAAGTCCGAAGGCGACAACTTCCTGTTGCCATCATGGTATAAAT
GCCGCGCGTTGACGCCCATCGCGTACGGGAAGGCCCAGTTCCGTCCTGCTGCGTGCTTGTGCACTTGCTCCAGGTAGTCCACGTGGGCCTCCATCCGGCG
CCGGAACTCGCTTGGCCCTGCGTCCATCCCTTCGTCTTCCAGAAACTGCGTCACCATTGCGTCCGAGGACATTGCGACGCCATCCCGGCCCGCCCACAGA
CACCGCGCGTCGTCGCAACTCCGCAGCGTGCCAAAGGTGGAAGGATCGTTCGCCTGGATCGATGATGGAGCAACGACTGTCGCGAGAGCGAGCAACTTCA
GCCACGACAATGGCGCCATCTTCAGTTGCTACTCAGATGACCCACCAAACTTCCGAGTGGCTTTTATATAGTAGGTGGGGGACTGCGGCTGGAGCCAGAA
ATGGCCGCCGCACTCGCAAGGGCCGATGTGGAATTGTTTCTGCCTCGTCCGAGCCTCGTTTGATTGCGGCACTAGGTTCGACCATACAAAGTTCAAGTAC
AACTGGTAGTCGTGAGTGACTCACTGAGTCAGCGGCCAAGATGGACTTGGTCAGCTGAGCCGCCATCGGTTGCTGCCATCCCCGACCTTGATCGATTGAC
GTTGACTAGCTTATTATAGTTTGCTGGGACAAAGGTCAATCATTTATTGAACCATCCCATGCGGAAGATGCCGCCCGCTGGTGTCGACGAAGTTGAGGGC
TCCATCATGGTCGTCTCACGCGCTGTGACCACAGCAAGGTGCGTCTGGATTTTCAGCCACGTTCACAAACACATGAATGGACTCGTAGGCCAGCCTGGTT
ATGCCTGCAAGAGGGTGCAAGACTGGCTCGCTTCACATCTTGTTGTTTGTGGAGCTTTTGTTTGTCGGATGCAAACTTGGGCATGTACTGGCACTTGCTT
CGCGCTGTTAAACCAAAGCTCATATTCGAATCCCATCAAACTCTACATTAGCTCGCTAGTTCGCACTCTGGACGTTCGTAGGGGTGCGCGCCGCGTGCAT
GGCCGAGTTCTGCTTGCGGATAACTTTCAGCTTCCGCTGCGACACCACCATCCCGATTGCCGTCGTGACCAGCGTGAAAATGGTGGTCGCAGCTGCAACG
CCAATCCACCCCGTCGGGCTCAACCCCACAAAGACCTTGTCACCACCGCTATCAACAGTAGTGCTCGCCTTCGCACCGGCCTTCGCACCGGTAGGAATAA
CGGGGAAGACGTTCAAGCCGCAGTTGATCTTGGCGTCCGCCACCAGTTTAATAAAGCCGCTGTCGCCCCACGAGCTGCCGTACGAGTTCTTGAGGATCCA
GTAATCACCAACTGAGCTGTCGGTGCCGTAGCCCACGAGCAATAGAGCGTGATTCAGGTCATTCTTAGACGCCATCTCCCCGTTGTTTGGGCAATTGTAG
AATCCGCCGGCGTACTCTCCAAAGCCGCCATTAGATGTGATTGCTACAGCAATgggctgcttctccagcgccgagcgGAGCAACGACGTGCAATTGCTAG
AAGCGGTGCAGTCAATACCCACGATCTGTTCCCAACCAGTAATACTTGCAGCCGCTTTATCTGCACTAACGGTACACATCGATGAAGCGTTTGAAGCCGA
CGAGCTCCCAGAATTGGAGTCGTCATACGGCATTGTGAGCTCTGTCACAAGTCCCCACCCATTCTGAGCCGCGTCCATAAAGGCGCCGTGCGTCATTCCG
CCGTTGCACCCGTCATTTTGCGATTCCCACTTGATCTGTGTCTGCATCCAACTGGCACCGTCCACGCCGCTGTCTGACGCCCAGCAATACTCGAACGTTT
GAGTTGTTTGCAATGTGCTGCACGTCAGGAACTGCTGCGGAGACAAGGACACGGCTGCTGAAGCGTTCTCCGCGATCACTACAGCGGTCTCGATcgcatc
tgcagcaacaaacgaccagcagcttccacagCTCTTTTGACTTTTCACAGGTGAACACACGCTATGGCCCACGGAGTTGTCTGTGTCGCACCAGTTCCAA
TACTCCGAGCTGCCTGAACTGGAGATCGTGCTGTTGGTACTGTTTGTTTGAGTCTGAAGACGGCGAGTGTATGCTGATACCATTTCTTGCTCTACGAACT
GCTCGGGTGTCAGCTTGTTAGACGACGAAGTCAAGTGACGCTCGTTCACACCCATGTGATACGAGAACTCGTGACCAACATTCTTCGCGTGCATATTCAC
GTCTGCATCGCCGGAAAAAAAATACAAATTGAGTTAGCTTACCGCTTGCAGACCCAAAAACTCTGCCATCTCTCTCACCTTCGATGTACGTCATGTGCTC
CTGGAGGTTGCGTAGGTTTGATTCTATATCACTGTAGGCGACGTAGTTGCGCTGGATAAACAGTTCGCGCAGCGTACGCGAGTCCACAACTTCGCCATTC
TCTCCAGACCATAGGCACGGCGAGTCTGCGGAGCGAACGGGAGGGCAGCCCACTAGAGTGCCCAGTGATCTATCCGTCGTGTGGACGGCAGCAGTagttg
ccgccgccgccgaaaGCGTGAGGACAACGGCTTGAAGCTGCAT