Description :
From Genome Similarity Track
Location :
scaffold_8:416- 37857
Transcript NameFunction/comments
g498.t1 conserved hypothetical protein
g499.t1 hypothetical protein PITG_03338
g500.t1hypothetical protein
g501.t1 hypothetical protein PHYSODRAFT_536873
g502.t1 callose synthase, putative
g503.t1hypothetical protein
g504.t1 conserved hypothetical protein
g505.t1 hypothetical protein PHYSODRAFT_536864
g506.t1hypothetical protein
g507.t1 conserved hypothetical protein
g508.t1hypothetical protein
g509.t1 conserved hypothetical protein
g510.t1hypothetical protein
g511.t1 hypothetical protein PHYSODRAFT_470654

Sequence
37441 bases(100 bases per row)
ATTGTTACTGCTTGTATAAATCACCTTTCCAGTCTTCTTATTCCAGCCTTCTCCCTCTATTATTGATGAAGTTACATGTAAGGTACGAGTCGACCATACA
TTCATGAGTTACAAGATCCCATCGTACGTGTAGTTGAATCATGCCAATTCGACGGTGTATTAAAGATATACTTCGAGGTACTTGCGAAGCATTCGCTAAA
CAAATCACATACATGTATTATACTTCGAAGTATATAAGTGTCGAAAATGGTATCTTGATGAAAAGAATGGTACATTTACATGTCGAAGTACATCCCTTAA
AGCAGAGGGCTGCTACATGTACATGTATTAATACTTCAAGTAGTACAACATTAATTGAGTCCAGTCTGTCGAATAGCAAAATTATTTGGTAGCGAGCACC
CGCAAACTTTCGGGGAATCAAACCTGGCTGTTACTCCCCGTTGTTTAGTCATTGCCGACATTGGCGAAACCTGCGTTTCTTGTACACGAAGAACCAGTTT
ACATCTACATTATTGTCGATTCTCGAGTCGAGTAGCGAGTATTACATGTAGTACTTCATATTTATTGCCAAGCCAACGCAAAAGTATTCGGCGCGAAAAC
TGAGTTGTTATTGAAGAAGTTGAATGTCCGAGCTATCAGCGATCTTAAGATCTTGCAAGCTAGCTGGGAAACTGCATCCTCGCCTCACCCAGATCGATCC
TTGCAGGCCTAGATAGTTTTCACAATGCCCACTCCATGCTTACACAGTGTCCGCGATTTGGTCAGCCTCGCTCGACAAGAATCCCAGTTCATCCTCCTCG
CGGATGGAAGGGCAGTCGCGTAGGATAGCATGAGAAATAGCGAGCGCACCGCTGTATCAAAACCCCGTGTTAGTATTTCGGTAGTCGCACACTGACAAGC
CAACCAGATGACAGATTTACCTAGCCGAGCAGATCGTAAAAAGGATCGATCCACCGAAAACGACAATGACAGCAGCGCTCACTGCGAACAAAACAAGGCA
ACGCATATCCGTCAGCTCGACAACAAGCAGCACCAAGGTCTTAAAAAACATACCACCGAGCATGCCAAGCTTCCGCTGGTCGGGCGTCACTGTGCGTCCC
ATAATCTTGGTCGGGTTCTCAGGAGACTCGTTCGCCGTCGCACTCGACATGTACAGCCAGAAGCCGCCGAGGCAAATCAGGACGAACAGGAAGAACGGGT
TCAGCAGACTGCATCAACACGGATACACCAGTAAGTAAACATCCACTCAGGGACTAAACTACAGCCAGCTCGTCCACATACATAGTAACAACGCCTACTA
GGGCCGCGGAGATAGCGTAATTGGCACTGAAGAACAGCGCATTCTTGCGGCACCGCGAGGCTAGCACTTCACGCCCAGGTACATTGAAAGGCTTCTCTTC
CCCTAAAAGAATCACAGATAATTAATGCAGTTAGCGAAACTTGCCAAACGTCTACAGTAGAGGGAGAAAGGAAGTGACGCACCAAGCCCAAAGAACTGGG
AGATGCCGCGCACATTCCGGATATCCACCGCCTTGAAGAGCTGGTTGCGAATCTTCTGCAGCGCATGCTGCGGCACCTCCATGGTGATGGTGCCCTGGGG
CTCGTCGGACGCGACCTTCATAGCGCTCATGGTGGTGCAGTGTGTGCTTCTTGTGCGATCGCGAGGGAAGAGAAGTGCCAGATAAATCTCTGTTGGCGAG
CTGCTGTTCGCTGAAAATAGCGCTCCGTGAACGAATCAAAAATAGCTACGGATCTTTTATTAACCAATCCGACGCCACCTCAGATCTATATGTCAGAGTG
AATGTCACTTCAACTTCAGCCATGCAGACGCGCCGACAAGGACTCAAGACTCCGATGAAGGCAACCTGCCAACTAAACGACTCGCCCGACGAGGACTGTG
AGTAGATTCGTCCTCGTCTTCGCACTGGCTTGTTACTTGCTCACGTCATTTCTTGGCAGCGTATTCTCGTGACGGGGATAAGGTCGCGTGTAAATTTGAA
CCACATCTGATGAACGGACTCTGATATTGCGGTACTGAACAGGAGAACGAGGTGAATGAGTCGCAACAAGGACGCAAGAGCAAGCGGAAGGATGGCGCTA
GAGAAGGACGTGGGAAGGGGTTGTCTAACAAGAGGCAAAAGGTGAACCAGTCTGCAGAGAGCCCAGAATCGCCCCCCATCTTCACCTTCAAGACGGCGAA
GACATCGTTCCGCAAGAGGAAGCAGTTGAAACTTGAGAGACTACAAGAGGAAGATGAGCAAAACAAGAAGCGCATCGAGGACTTGATCGCTTACTTCAAG
AACTTGGACGAACAGAAACTGGAGATGGCTTGAGGTACGAGTGGGTGGTCATTTTGTGCATTCCTTTATTGTTATGACAAAATAGTGTTGGTGGCGATAA
CGTAGCTCATACCGACTGTGTCGTCGCCAATGCCAGAAGCTGGTCGCAGTAGCGAGGACTTTGGTGACGAGTCCGATTCTCTTCTGCCTTTTTTGCCAGT
CGAGGGGCATCAATTACTGCAGTTTCCTTCAGCACCTCGAAGACAGCCTCCTATCAGTCAAACAACAGTTAGTTAAATTCACAAAAGTACATGTAGAGGC
TGCCCAACAATTGCTTACCTGGATGTCGGCCTCTGAATCGTCTAGGTGGACGAAAAGGCAGTCCAACGTATAGTCAATAATCGTTCCTCTAAAATGCTCC
TTCGGTGCCGCTTTCAGGAAGGTAGTAAACGTTTGACAGGCAGCTTTGCGTACAGTGTCGTTGCTGTCATCCAGACGCTTCAGAATCTCTGCGTACAGTT
GGTGTACCGGCTCCTCTGTTAAAAAGCCAACAGCAAAAGCTTCCAGTCAGAATAACAGCGTTTCAAGCACAAGCAGTATCCATGACATACCTCCCAAACA
CCCAGGTAGAGCAACGAACAGATACTGCAGTGCGAGGCAGACAAGTTGACGGGTCTTGGCATCACTATCATCCATAGATGACTTCAGCACGGGCAACATC
TGCAATAATTGTACGGTCATTTGATCAGCACAAGAGGGTTGAAGCAATATAGTTCGAAGTACACAGTTTTCACCTGGGGAGCTGTTTCAAACAAACATGG
TTGATCGGCAATACCCTGCCGGAGGAGTGTATAGGCACATGCAACAGCAACTTTTCTGAAAAAACATCAATGCAATAGTGCACACATCGTCGGATCAGCA
GCTACAATAGAAACCGAACCATAGAAATAAAGGCCTACCTAATAGTTGCAGCAACGCGTCCACCACGCCAAACGATGTTTGGGATAATAGCCTTCTGAAG
CAGCGTCATGCTGAAAGGCTTAAAATCCTGAAGACAAGAACAACCACAACACGCATTCAGTTGAACCCACAACACAAATCTAAATACTAAACAAATCTCC
GAACACAAAACGTAACATACCAGGGCGATAGAATCCATCCCTAGCATCGTTTCCAGCAACGCAAGGAAAGCAAGCCGAACATCCGCATCCTGAGCTGGTT
CGAGATGAACCAAGAAGACTGGAACAATTTTCCCCAGGCTTTTCCCACATGCCTAATATGACAGAGCATCAATAACCGAGATAAACTCTTTGCACCTAAA
GCAAAAGTTCGTACCGCTCCCCCACGCCGGCAAAGCGAGTCAAATAGTACGCGGTTTGAGTTACTTTTTTGCCAGCTTGCATTTTCGCTGGTAGGGAGTA
TCGTATCGAGGAGTCTGTCGGTGTAGCGTACATATAGCGCCTGTAATTCAATAGTAAGATAGTTAGTGAATTAGCACCACCACTCGAAAGTTTTAACGTG
AATAACTAGCCTCAACTCGCTGTTCCATCTTCACAGATAGCTCATCCAGGGACTCGGTTGCCTGAAGGTATGCCAAAACATAATATCCCCTCCGTGTCAC
CAACAATCACCATGCACATCCAGCCAGAACACAACGTACCGTTTCATAAGCAACCGATGACTCCGAAGACGATGCAAGGAGGTGGCTCACCACCCAGAAA
AGGCGAAAGCAGATCTCGTCCTTTTGCGCGAGAAGTGGTCCAGCAGTCTTGATAATACTGGAAATAACACCAGCCAATTGGTCTTGTAGGTCTACCATTT
CCGATTCGCGCAGACCGGCATCGCACAACGCTTCGGTGATCAGCTACATAATTCCAACAAACAAAACACAGAAATTGGTTATCAAAGGCCTTGAATAGTC
CCTAATAATATTCCTTACCTCCACATGGGCTCCAATTGTCTTTGCTGTCATGCCTTCAATGCTCATACCCAACAGAATCAGCCCGTTTGTACGATGTTGA
GCAGTGTCCTGTCCTGCTAATCTTCCAGCCACCATCGGCAGCAATGAAGCCAAAATCATTTGGGAGTCAGCATAAAATCCCACAACGCCCGAGCACGCTT
TCACACTGTTATAAACAGCTTCTTCTTCATCGCGACATGTCTTGCCCAGTGCTGCAAAAACCTTGTCGAGGAATGGGTTCATGTTCTGCTCCAGCAGGAT
CAAATATGCGCTAAGAATTTGGGTGTAGCGCTCGCGCGCTTGAACAGTCCAGTCTGCCGTTTTCTCTAGAAGCGGTGGCAACATCTCCGCTTGGATACTT
GCTGCAAGCTTGCGGGCACCAAGTGGTGGGCGCGTCTCGAAGAAAAGAGGTGGGGTGCTTTTTGTTGAATCCGCATCCACGTCCATGAGCTCTACACCGT
CTGCTCTGACGCCTCCGTCTTCATCTCGAATTTCCCAAGTAGCCGAAAGTTCATTCAGTTTAGCAATAGAAAGCGCTCGTACTTCGGGCGATTCATCAAC
GATACCAGCCAGGAAAAGTGGGAAGACAGACGCCTCAAACTGCTGAATTTGCTCGATTTGGCCCAGCCACGACGCCAGTGTGATCACTAGCTGCCTCCTC
ACGGACGGAGCATGGTCAAAAATGACCTTGCTTACTGCTGGCAAGAGCACTTCCTTCATGAGTTCCGATAGAGCTTCCGAACCGCATGGTACAACCGCTT
CCAGCGCCTGTAACGCGCACACACGCACGCGACTGTGTTGGTGGCCCAAATTCACCGCGATAGGTCGCACAATAGTGCCGATCTGCATCCCCACATCGCT
CTTCCAGTTCTTCGAGATTAAAATGACGCACTCCGCCGACATCTTCTTGGCATCTGGGAACGGGTCCACTGCCGACTTGCCCAGTGCATTGGCCAGCTCG
GTGATGACGTCGCGCAAAGACGTCTGCTTATCTGTAACCGCAGTAAATTGCTTCAGAAATGCGTGCAGCAGCTGCAGAATGAGCAGGCGAATCTCCTCCG
TGGGCTCCGGGTATGGCAGTTTGCCCAGTCGAGCGTTTGCCAGCGCCACCAATTCCTTCAACGTCACAGCCGATGGTTCCAGCGCCCCATGTTCGCATAG
AAACAGCAGCGACGTGAGAGCTTTCTCGCGGCACTTCTCCACATAATCAGTTTCGGCGCAGTGAAGCAGCGGTCCCTGCAAGTTCGAGACACACAAAGCG
CGAAGTACAGCAGTGGACACACGCGACGCCTCGTTCTGCAGTGCACGGTGGATCTTGTCCGCGGCACGGCGGCGCACGCTGCGGTCGGAATCGGATAGGC
AGTTCACGTCGCGCTGCATCTTCATGGCCAACATGTTAAGCGCGCTCGCATCATCTGAAGTCAGCGCCATGGCTCAGATCCACTCGTCGACGATGCAAGG
ATATGTTGCAGCCTTCGCTAAAATTCGGTGCAAATGGTGTGGTACACTCCAATTACTGAAGTAGCGTTAGGTGAAGTATACAATGTATACAATATACATG
TACAGTTGAAGTGTATGTACGTATGTATGTAAACGCGTTTCGGGAGCCGTCTTGCCATTGGAGTGGCTCAACTTAGTTGAAGTGATTAACAGGAAAACGA
TACGTTTTGTTTGCAAGCATGCACACTAGGTAGTTGCTCTATGTGTCGTGTGACTCGTCTACTGTTGCCTCTATAGAATACGAATTATTCAGGTCGCCCT
CCACGAACGCTGTCGGTAAATCGCCACGTCTTGCAGCCGGTATCACTACCGCAGGCTTACTTCTTCTTACCCTGCGTCCGCTTGCGGCCGTTGGCAGTAA
GCTCGCGCTTGCGCATGCGAATCTTGGTCGGGGACACGTCGATCATCTCATCCTCGCCGATGTAGGTGACCACATCTTCGAGGGACATCTGGCGAATTGG
CGAAAGCTTGATGTTTTCATCCGTGCCGGCTGCGCGCATGTTGGTGAGCTTCTTTTCCTTGGTGGGGTTGATCTCAATGTCCGTAGGGCGGCTGTGCTCA
CCCACGATCATGCCCTCGTACACCTCGTCTCCAGGTTTGACGAACATCTCGCCGCGGTCTTCCAGCGAGTTCAGTGCATACGCCTGTATCGAATAAGTAC
ATCCTCGTGATTAAGTCTGGAAAATAACGCACTAACAAAGCCCATTCGTACCGTGCATACGCCACCAGACGAGGAGATCAGCTTGCCCTTCGACGGAGGG
GTTGCTGTGCCTTGGAACGGTGAGTAGCCGTGGAAGATCGAGTTCAAAATACCACTTCCGCGGGTGTCGGTCTTGATCTAAACTCATACATGCACACAGC
AACGAGCGAGGTGAATCGACATTCTCGCAGGTACGGATAGAGTAAGTCAACAAGATACATACCTCACTACGGTAGCCCATGAGGCAGCGACTCGGGATCT
TGAACTGTAGACGCACTTTGTCGTGCATTTCCTTGAACTCAATGATCTCACCGCCGCGGGTCGACAGCTTGTCGATAACCGTACCAGAGAAGTCGGTGTC
AACATCGATCGTTACTTCTTCGATGGGCTCGAGCTTCTGTTTAGTCTCCGGGTCCGTCTGGAAAAGCACTTGAGGCGCCGAGACGGACATTTCGAAGCCT
TCACGGCGCATTTCTTCAATCAGAATGGCCAGCTGAAGTTCACCACGGCCGTGGACGTCAAAGGCCTCCGACGAGGCGCTGGATGAAATGGAGATGGCAA
CGTTGTTCTGAAATCGCCAAAGGAGTTAATGATCCGAGCCGGGCGATACACACGGTGCGAACTAAAAACTTACCTCGCACTCACGCTCGAGACGCTGCTT
GATGTGAGAAGACGTGAGGAACTTGCCTTCCTTGCCTGCGGTCGGCGCATCGTTCACACCAAACGTCATGGAAATCGTGGGAGGATCCAGCTGCGGGGAC
GGGATGGGCTCCGTCACAGCAACATCGGCAATGGTGTCGGATACGTACGCGTTCACACCAGCGATCGTGATAATATCACCTGTTATACATGTAGAACCGC
GCGTGTAAGATATCACATCCTTACAAACATGTCAAGGCGATAAACGCACCAGCAGTAGCCGACGTGATCTCAGACTTCGCAACACCACGCGTAACAAACA
TCTTCGTGACTCGGCCAGTTTCTAGCTTCTTGCTCTCGCGGTTCATTACCTGGATCGAGTCGCCAATCTACTCATTTCCCAACAATCCAGATACGACAAC
AGTCAGTACAAAATAACAACACGCTCAAAAGTTGAGCGTACACACCTTGACGGTTCCGGCGTGAACGCGGCCGGTGGCCAAACGACCAACGTACGGGTCG
TGGCCAATCATGGTAACAGCCATAGCGAACGGCTTGTCAGCGTTGGCCTCCGGGGAAGGTACGTAGCGCGTGATCTCGTCCAGAAGCGGCAGCATGCTGT
CACGCGTCTCATCCGCGTTGTCCAAGTCATGCACAGCCCAACCCTGCTTAGCAGACGCATACAGCACGGGGAATTCCAGCTGGTCGTCGTCAGCATCCAA
CGCCACGAACATGTCGAAGAGCTCGTTCTCCACCGAGCCATCCAGGCGACTGGTGTCGCGGTCCACTTTGTTGACGACCACAAGCGGCTTCAGGCCGCGG
TGCAGCGCCTTGGTGAGCACAAACTTGGTTTGCGACATGGGTCCTTCTGTGGCATCCACCACGAGCACGACTCCGTCAACCATACTCAAAATGCGCTCCA
CCTCACCACCGAAGTCAGCGTGACCAGGCGTGTCGACGATGTTGAGTACGTGGCCGTTGTATTCGACACGCGTGCACTTGGACATGATGGTGATGCCGCG
CTCTCGCTCCAGATCAATAGAGTCCATCACGCGCTCCTCAGAGAGCTGGGTTCCGCCGTGCTTGAGCAGCTGGTCCACCAGCGTGGTCTTGCCGTGATCG
ACGTGTGCCACAATGGCCACGTTGCGGATGTTCTCCGCCGTGACGGACGAGTAATCGATGGAGAAGGCGCGGGCCAGCACGGGCGAGTTCCGTTGCAAGA
GCGAGCGCTGTCCAGAGCGCGCATGCGCCAAGGCAGGAAGGCAGGACCGGCGGAGCCACATGATGTCGAGCAAGTTCAAGCGGTTGATGCACAAGTCGTT
GTGCGTGTGTGGCGGAGAGAGCGATCGTCAAATGGTGTGGAACACATTACATAATGTGTGGTACTTATTTCGGTGGTGCAGACGCTGATAATGTAAACAC
ACAAATTAACGTGGCACACACAGGGTATCGATCCAGTACATGTACCGGTTTTCCCAGAATACCATCCATGTAATGAGGCTTTTACCGCGAGTTTGTTGGG
GCCGTTTCAAAGGTGACGTTGTGCACTACCACACAATAGTGAATGCTGTACATGTACATATCGCAGTCTGCTTCTGGATCGATTGATATTTGATGACGGA
CTCGTGCCGTGCCAGACATGGTACATGTACCGGTACCGGTCTTATCAATCAAGGGGGTGGACCGTCTATTTCCTTCGCGGCTTCGAAATATGTGTGCCAC
ACCATGCATGTCAATTCCAGGTGTAGGTTTCTGCTGTAATCAGAGCCACTGATGTGGAATCGAATCTTGCCATGTTGCAAGATACTTTCATGGCCGCATT
GAGGAGACTCCGACTAGGGGTTAATAATGGATTGGGTTAATAGATCGCTGTGAACCGTATTGGTTCGCCGTGTTCAACATTGTTAACCTAGATGCTGGTG
CTTGTACACCGGTAAATGTAACTTTGGACAAGTGTGGCAGCCTGGTGCAGCGTCTTTGGTGGCTACCTTTCCTACGATTTGAAGGTCAAACTGCAACGTG
GAGCCCGATCTCTGTGTGTGGAGCCCGATTTCTAGCGGCCAGATCGACCCAAGCAGCACGGCTGGTGGCGGACCGATCGTTGATGCTCGCAGCGTTTGGC
CAGAGGGAGCCGCAACTTGCGGCGCCGGAGCTGCGCATGAGTCGCGGGCACCAATCCCCGTGGTGGCAGTAAATCAGGGATCTTTTTGCCTTGACTTCCT
CTTCCGCTTCTTCTTCAGGCCGGTGGAGGTCTCAACGGCGACTGCAGCCAGTAAAGGCCGAGTGTGACATTCGCGCCGACGCCTCCAACGCCGGCTCCGC
CTGTGAGAATTCAAAGCGAGGGACAAAAGAAGGGTATTCACCCGCCCGCACGTCCTTTGCTTGGTGCTTGGGGCCCCTCCAGCTGACCGGCGCCAGTCAC
TTGAGCTCGGCACGGAGCCCAGTCAGCTGGAGGTCCCACGTTCCCACCTTCGAAATTGTCGAGCGGGTGGGCTGAAACATCACTTGCACTTTGTATTGCT
TGACTCAAACCCGGTCCGGGCCCGTATCCGACACGCAGCCTCTATGTCAAACCCAGACCCACTGATGCGGAAGATCTGCCAAGGCCTCATTCCGCATTTT
GCAGGCCGACGCTGCCCCCGAGAGCCCCCGACGAAGCCCGCCCGCTATGGCGCGCGCTCGGATGCAAATGACGCAGCTGCTGCTGGCTGTGGCGCTGCTG
GTGGCCACATGCGAGGCGGCCATGCCCATCACGATGGCGCTGCAGCGTGTCCGCCAGAATCTCACAGCTCTCCAGAAGCAGTGGATCGACCCGGACACGG
ACCCAAAATTCTACAACCTGTCGGTGCCCAAGGGCGCTTTCAACTTCGGTGGCAACTCCAGCTACAACCACGAGTACAAACTCATCTTCTCGGACGAGTT
CAATAGCTCCAAGCGCACTTTCGAGGCTGGCTTCGACGCTAAGTGGACCGCCATCAACATCCGCGACGAGACCAACATGGGCCAGCACTACTTCTTGCCC
CAGGCCGTGCAGATTGACAAGGGTACCCTCATCATCACCACTTCCAAGCCCAAACACAAATACCGCGGCACTAAGTACGTCAGCGGTAGCGTGCAGACCT
GGAACAAATTCTGCTACACCGGCGGCTTCGTTGAAGTCAAAGCCGTCTTGCCAGGTAAATGGGGTATCCCAGGCACGTGGCCCGCCATCTGGATCATGGG
TAACATCGGTCGTGCGCCGTTCTTGGGCTCTCAGGATGGCACGTGGCCCTGGAGTTTCGATGTCTGCGCTCCCTACGTGGAGAAGGTGGAGAAGGTCAAG
CAGAAGATTAATGCTTGTGGCAACCTGACCAATAAGCACGACAAGGCCTCGTACCCGGAGATGTATGGACTGAATCCCTTCCAAGGACGTGGTGCCACAG
AAATCGATGTGATCGAAGCGCAGATTCGGGGGCGCGACCTACCGGCGCAGATTTCCACGTCGTTGCAGATCCGTCCTAGTCTGTATGACGATATGCGTCC
AGGTTCCGAGACGCTTCCTGGCCCGGGACAATGGTACCAAGGCCTTAAGTTCGGCGAGTTCACGCGCATCAACAGCGATTACTACGGCGAGATGGGCCTC
GACTCCATCTCAGCGCTGACAACGCTGGAATCCAATGCCTTCAAGGCGTACCACTTGTATCGTCTGGATTGGTCTCCTGGTCCGGAGGGTTATATCCGTT
GGTGGCTCGACAACAACTTTTTGTTTGAGATCCCAGGTTCCGCGTTAAACAAGTGGGTAGGAGATGTCCCTCCGCGCCAGATCCCCGTGGAGCCTAGTTA
CCTCATTTTGAGTACGGCTGTCTCGGAGAAGTTTTCACCGCCGTGTGATGGCCAGATTTGTGACTCGCTGTGGCCGTCCAACTTTACAATCGACTATGTT
CGTGTCTATCAGGGCAACCCGAACCGGTATACGTCGATAGGCTGCAGTCCGGAGGCGTTTCCGACTACCGACTGGATCTACGCCCACCCTGTGGAGTATG
GTTTGCCGTGGTACGTTTCGTTGCGTGTAGACATCGGGCTTTTGCAACTGTTCGCAGTGGTTAATGCGTTGGTGGGTCTCTTCATGGCGTTCCGTGGAAC
GTCTCACCCGAAGATGCTGTCGGCATACGCCTGCTCTCTGTGGCTAACTGCGGCATTCTATGGAGCTTTAAGTGAAAGTGCTCCCGAAGATTTTGCTTGG
GTCCAGACCGCGCTTGCGTGCTTGTGTGGTTTGGTGCTTGGCGGCCTGTGCTGTCTGATCTACCCAGTTTCTTCGGGAGCGATGCTTGGACTGTACGGCG
GTGTGATGCTTAGCCAATTCGTGCCGTTATTGTCAACGCGTGTGATTACTGCAGTGCTGGTTGGTGTGGGAATCACGCTTGGATGTGCCCCTCGGATTGA
CACCAAACATGTTGTGATCCTGTCGACGTCTTGGCTTGGCAGTTTGGCGTTTTTACTATCGGTGTCGCTGTGGGTGAGCGAAGGTGACATAGCTGAGAAC
GCGTGGAGCCTTGCTGGCTTCATCTTCAACGGCAACGACAGTGACCACGTCGGGTTTTGCTCACAGCATTGTCTGGCGATGTATGTTCTGCTTGTCATGC
TTAGCGCAACTAGCACAACGTACGGATACCTCCGTTTGCGTGGTGTGTCGCTGTGTAACGACATGATTAATGCACGCAAGGCCAAGTTCCCCGCAGTATC
TGCGAGCTCGGACGCTAGATCGTGGAAGCCGGAAAGTGACGAAGTGTCGGGAATGGAGAAGAACATGGTGAACTTTTTTTCGCCGTCGAGGTTGCCGCAC
AATATGCAGCAGTTTAGCACCATCTTCCGCATTGCTGTGAACGTGCAGCGTTCGTTTGGCTTCCAGCTGGACAACTTTCGCAACCAGACGGAGCACATCG
TGGTCCTTCTTACCAACAATACGCGTAAGGGTGGCAACCCGTACCGTAAGCTCCACGATTTAGTGTTTTCCAACTACAACAAGTGGTGCATGAAGCTACA
GATCCAACCTCTGCACTGGAGTGAGCAGCGAGCACCGCAGGGGGGTCTTACAAGCGTGGACGAGATCTCGGTGGATTTGTGTCTGTTCTTCTTTATCTGG
GGTGAGGCAAGTAACTTGCGTCACTCGCCGGAGTTCTTATGCTTCCTTTTCCACAAGATGAAAGAGGAGTTCCCGTCGGTTCGTCACTCGGAGCGTGAGG
CTGGCTACTTTTTGGATACGGTGGTGACACCTGTGTATGGTTTGCTAAAGGCTGAAATGACTTCAAAGTACGACCACGAAGATCGTCACAACTATGACGA
CTTCAACGAGTTCTTCTGGACCAAGGCGTGCCTCAAGTACGATTACAAACATGAAGAGGTCATTGATGTTACGTCGCCGAACCCAGCCATGATCTACCAA
CAAAAGAAGCAGCAGCGCCAGGGCTTGAGCAGTCTTGGTGGCATCAGCAGCCAAGGTGGGCTTAACGGCGGCGGAAAGAGCTCCAATTTCTTCAACAAAC
GCAAAAGTATTGCTGAGGGATTCACAGAATCTGCGAAGACATTCGTGGAAAAGCGGACGTGGATGCTACCGCTGCGCGCGTTTAACCGTATCTTCAACTT
CCACGTGATCTCATTCCACTTCTTGGCAGTGCTTGCGTTCGCGAATGAGCAAGAGATGAACTTCGAAGACTCGTGCAAAATTATTTCAAGCACGCTGATC
ACCCCATTCTTGTTGGATATTCTTCGTGACGGACTGGACATTTTCGCTGTGTACGACGAGCACCAGAAGACGTTTTCGACAGCGCGTAATGTTATACGCG
TACTTTTGCACCTGGTTCTTGCGGTGGTGACTACGATGCTGTACTGGTACGCGTGGGCATTTGGCAGTGTGTGGTGGCAGTTCTACTACATCGTTGCAGT
GCTTTTCCACGTGCCAGGCCTGATTAATTGCGTCATGCAGGTCATGCCTGGTCTTACCAACTGGACGCGGCGCACGACATTCGCTCCTATTGCGTTCATT
CGTGACATCGTGAGTCCGATGAATCGCCTTTATGTGGGCGATAACGTATTGGACCCGGAATCGATGAGTGTGGGCTACCAGTTCTTCTGGGTCTCCCAGT
TGGCATGGAAACTGTACTTCAGTTACAAGTTCGAGATCTACCCACTTGTGGTGCCAAGCTTTTTGCTGTTTGCTGATCATGTCGAGAACAATGTGAGCTT
GATCATGACGACGTTCCTCATCTTTCTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTTGATATTACGATTTGGAATTCCATATGGATGGCTTTCACG
GGAACTTTCGTGGGCTTTTCGGCGCGCATCGGAGAGATTCGCAATTTCAGCCGTGTTCGCTCATCTTTCAGCCGTGCTGTGGATGCGTTCAACGCTAAAG
TGATTGCCAGAAACTCCAAGACTGGACTGCAACTTACGGAGAGCCTTGGTATGTCTTATGGCACGACGGCGGTAGGCCATGAAGTGCTTGATCGTGTTGC
TGGCGGCGCGGATCCGACAGCCCGAATTCTATCCCAGCGTCGTACCTCAGTGCACGATGACGAGACCCCATTGCTGTCTTTCTCGCGCCGCAAACAAACG
CCAATGGAGCGTCAAGCAGCCCGCCGTCGCAAGTGGTTCTCATTTTCGGTAGCATGGGACACGATCATTGATAGCATGCGCGCGGACGATTTGATCTCAA
ACAAGGAAAAATCTCTGCTGCACTTCCACCGCCTCGATGGGTACCAGCGTGAGATTTACCTCCCGCAATTTCAGCTAGCGGGCTGCTTTGAGAACTTCAC
TTCGAACATTCTGGACATTTACTCTTCCAATGATGGTAAGGTGTCAGAGCGTGTGCTGCAAGACAAGCTGCTGGAAATTCTTAGCGAAAGCCCAATGGTG
GAGGAATCTCTTGAAGAAATTTGGGAGCTGGCGAACTGGGTACTTGTCAATGTGCTTGGCCCGTGCCACGCGAATGATGTGAAGTACATCACTACCGTGC
TCAACTCGTGGGCAGCACGTGGTGTGTTCCGTGCTCTTAACCTGCAGAAGGTGGCTCCCTGTGGCCGCGCTTTGGCAAGCTTGGTGTCGCTTTTGAAATC
CAATGTTCGTGGCTGGAAAAACAACGCCAAGGTGATCCCTGTGCGCAAAGATCCGTCGGAATACGCGTCGTACGAGTTTCCGCAACAGTCGAGTTCATAT
CGCCCTGCTCCGTCCGGACTCACAAAGTCTGCAAGTACGACGGGTCTGTCGTCGCTGGGTCTCGAACCTCCTCGTCGCAGCCGTGGTTCTGGTGTTGCAC
GTATTGCGCGTATGCAGCAGCAGACGCACAAACCCGCTGTCAACAACGGCAAGGTTTCGCACTCCATTCCGAGCGCTCATATCATGCAGATTCGGGAACG
TGCTCGCACATTCCTAAATCTCGGAAAGGAGATTCTGGCGCATGTTCACGAGCAGGACCCGGTGTACGCCGAGAGCAAGGGCATTTCGGACCGACTGACG
TGGATCCTTACCCAAGAACGTGGTTTTATGTGGGACGACAACTACACGGGTGAGCAGATCACGCTCACAGCGTTTGAAAGTCACACTGATGTGGTTCTGT
CGCACCTTCATGGGCTTTTGACCTTGCAGAAGATCGATGCAGAGCCCCAGTCGTACGATGCTCGTCGGCGTCTGCTGTTCTTCGTGAACTCACTGTTCAT
GGATATGCCGCTGGCCCCATTGCTTGAAGAGATGAAGTCTTGGAGCGTCATGACTCCATTTTACGCTGAGGATGTCCTGTACTCCAGAAAAGATCTGGAA
AGCAAGCAAGATGGTCTTGATGTGCATACGTTGCTGTTCTTGCAGACGCTGTACAAGCGGGATTGGGAGAACTTCTTGGAGCGAGTGAAGCCGAAGAAGA
ACATTTGGAAGGACCCGGAGACTGCTATTGAATTGCGTATGTGGGCTTCTCTGCGTGGTCAAACACTTTCGCGTACCGTGCAGGGCATGATGTACGGCGA
AGCAGCTATCCGCCTGCTCGCTGAGATCGAGCAAGTTCCGCAGCAGAAGCTCGAGGATTTGATCAATTCCAAGTTCACGTACGTTGTGGCTTGCCAAATC
TATGGACGTCAAAAGAAGAACAACGACCCAAAGGCCAACGACATTGAATTTTTGCTGCACCGATTCCCAAACCTGCGCGTGGCTTACATCGACGAAGTGC
GCGTTAACTACCAGAAGGAGCAGTCATACTTCTCTGTTCTCATCAAGGGTGGTGAGGAACTTGGTTCGGTGCATGAAATTTACCGTGTGCGTCTGCCAGG
CAACCCTATTTTGGGCGAAGGTAAGCCTGAGAATCAAAACTCGGCCATCGTGTTTACTCGCGGTGAAAATCTGCAGACAATCGACATGAACCAGGATGGA
TACCTCGAGGAGGGGCTGAAGATGCGAAACCTGCTTGAAGAGTTTGACAAGGGGACGGCTGACCGGCCGTACACAATTGTGGGTATTCCGGAGCACATTT
TCACCGGCAGCGTCAGTTCTCTAGCTAACTACATGGCACTGCAAGAAACGTCCTTCGTGACACTGAGCCAGCGTACCTTGGCGCGTCCTCTGCGAATGCG
TTTGCACTACGGCCACCCTGATGTGTTCAACAAGCTTTTCTTCATTACGCGTGGTGGTATCAGCAAGGCGAGCAAGGGTATCAACCTCAGTGAAGATATC
TTTGCTGGCTACAACAACTGCATGCGAGGCGGATCCGTGGCCTTCCCAGAGTACACGAAGTGCGGAAAGGGACGTGATGTTGGCATGCAGCAGATCTACA
AGTTCGAGGCCAAGCTAGCACAGGGTGCTGCAGAGCAGTCGCTGTCACGTGATGTGTATCGGATTAGCCAGCGTCTGGACTTCTTCAAGCTGCTATCGTT
CTACTACAACCACGTGGGTTTCTACCTGTCGACGTCGATCATCATATGGACAGTATACTTTCTGCTGTACTGCAACCTGCTCCGTGCTTTGCTGTCACTG
GAGGGTGTTGGTGGCCGCGAGCCGGTGTTGCTGAGTAAGCTGCAGCTGATGCTGGGGTCTGTGGCGTTCTTCACAACTGCACCGCTGCTAGCGACGATTT
CAGTGGAGCGGGGTTTTAAGGCTGCGCTGAACGAGATTGTCGTCCTTTTCGTGACGGGTGGCCCGCTGTACTTCCTGTTCCACATTGGCACGAAGTGGTT
CTACTTCGGGCAGACGATTCTTGCTGGTGGCGCGAAATACCGTGCGACAGGCCGTGGCTTCGTGACGAAGCATTCGTCCTTCGATGAACTTTACCGCTTC
TACGCTAGCAGTCACCTGTACGCTGCAGTGGAGATCGCCATTGGCCTTACGATTTACTACAAGTTCACGGTCGGCTACCAGTACTTTGCGATGACGTGGT
CATTGTGGCTTGTGTTCGTGTCATGGTACTGGTCGCCTTTCTGGTTCAACCCGCTGTCGTTCGAGTGGTCTGATGTGATGGAGGACTTCCGCTTGTGGTT
CAAGTGGATGCGTGGTGACGGAGGCAACCCGGACCAGTCGTGGGAGGCGTGGTTTAAGGAGGAAAACGCGTACTTCTCGACGCTGCGCCCGTGGTCCAAG
GCTTGTATTACGCTTAAGGGTGCTCTTTTCGCGTTGATAGCGGTCTCCATTGCTTCGACGAGCGACGAATATCACTCGATCTTGACGGAAGCTACGTGGC
TTCCATTGGTTACTTGCTGCTCGATGGCCGCAGTGTACCTGAGTGCTGAAGCTGTTTTCTTCACCTCGTCGCGTTACGGCGAGAACGGACTTGTTCGTTT
CCTGAAGCTTCTTTTGGTGCTTGTGTTAGGCTCTGGCCTCATTCTCGCCTTTATTTACGTGGATGGCATGTGGCAGACCATGCTGAGCATGGGATACCTC
GTGGCTGCTGTGGGCTGCTGGGCACTTCTGCTCTTTGGTAGCAATTCGCGCTTTGTTGGCTCGCTTTACTTCGTGCACGATGCTGTGCTGGGTCTGGTTT
CGTTGAGCCTCATCCTGTTGCTTGCGGCTCTTTATGTCCCCGGAAAGATCCAGACGTGGCTGCTGTACAACAATGCTTTGAGCCGTGGTGTGGTAATTGA
GGATATCTTGCGAGCCAACTCGAGCAACGACGACCGTGACGAAGACCTGTCGGTGCAGCAAATGCGCTCCATCATCATCGAGCAGCAGCGTTTTATCAAC
GTTCTCACCGCTAGCGGCAGCGAGACGGACATGCGCGCCACCGGACCTGTGAAGAAAGAAGATCTCATGCACGCTATGAGTGACAATACGCTCAGCGCGG
TGCTGAGAAATATGTCGGAGTCGGAGCTGAGTGCGTTGCAGGACTCGTCGAGTCGTCTGCAGGCTATCATGTCAGAGGAGGAGCGCAAGGTCGCGCATCG
CAAGCAGCAGCAGAATGAGCAGAGACTGGCTGAGGCCGGCATGAACCCGTCGTTGTCGCGCACGCGCCGTGCGTTCTCCACGAGCGATTTCTCAGCCATC
CCGCAAAATGCGAGCCCATTCCAGCTCTCAAGTCAGACTGGCCCAGCTGCCCCTAGCAATGGAAACACCACTAATGGGAAGAATCCTCACTCTGCGGTGT
AGGTAGACACTAGATTTGCTAGACGAACATGTAGGTAGAGCAAGAAAGCATTTTGGATAAGAAACTGCCTTGTGTTCAACTATTGTGATGCATTTTACTT
TTACTCGGGAGTTCTTGCTTGTTTTGGCAGGTAGTACGCTACGGACACATACATCGTACTTCGCTGAAGTAAGGTAATACACAAGAGCCCCCGATGCGGG
GACTACTGAGGTCTTGCTTGGGGGCAGCAACACTCCTCGGGCTGATCACTGGTCAGACTGCTTTCTGGATCTAGGCTTCTTCCCAAAACCACTGAGGAAT
TTCATGTTGGCACTCAACTTTTTTGTCAACGAGCTTTTCTGGAAAGAGTCAGTGTTGTACAGCACAGCCGTCTTGAAATTCTCGGCTACCTCATGCTCGC
AGTCGCAGTCCTCCAATTTCTTCTCGATCTCCTCCAAGTTTTTCTCCGAGATAGACCGAATAGTCTCCACGTCCTCGACCAGCTGAGATGAGGATACGTT
GGAGTAGATTTTGCGACTGTCTGCTGCGAAACATTCGTCAATATCTTGGCTTGGCGACATTGCCAAATTGGCGAAGAGCTGCTGAATCGCTGGAGAATTT
TTCTCGATAAAGGGATTGAGAACCCTACAAGTATCAGAACGATTCGTAAGTCGCAAAATCAAAATAAACCTACTGAAAAGCTGCACATACTTGAATTGGG
GCTCTCGGTCTCCAAACTTCACACCGGTTGCTGTCTTGAATAGTAGCTTCGTGACGAGAACAAGAACTCGTCGAGTCTCAGGTGGTGGAAGTTGCTTTGT
TAGACCGTACAAATGCGGAGTGGTGATGGCTGGGCACACGAAACGAAGGAAAAGGAATCCTCCAATCACCGACTGTAGAAGGGAGAACAACATTGAGTTA
GACTCGAAAACACCACAGCAAACCTCGTGTTAAAACGCACCCGAGTCAAGGTTGAGGCGTCTTCTGCCTCAACACCCTCCTTTGAGCCGTCAAAACGACT
GATGACCTTCGTGTTCAAATGCGAGCAAATGTGGAAATACGATGAAGGTATCTACGAACATCGAATCACAATTCCAAGTTAGTTAAAGCCGCCAACCACA
ATTTTCCGAGAGACGATACTTACGCAATGTGTGTTCTTCATGATCGAGTCAATGATATTCTGGCACGTCCGCATGAGGTTGGCAGCATTGGTTTCAGCTT
GATTCTCATCCTGTAACGACTCCTCCTTGTGCGGGTTGAGCTCCATGTCTGCGATCTTCAATTTAAATATCTGGCGGATAGGATCCGAAAGAGCCACTCG
GATGAACTTCGAGCCAATTGCTTTGCTGTACGTGGACACTAACCGGCTCGCATAATCATCCGAACGAAAGAGTGTTGCCACGTTGATGACTGAAGCGACC
TCAATCTCGATTGCCCAGCGAATAAGGTGACTGAGGCGGTTGTGACTCCCAAACACCCGGAGGAAAGGGGCTAGCAACAGCATTTTGTCTTCTCGGCCAG
CACTCTGAAGAATAGATGCAACGACTGACATCGTATCTTCCACAACTAACGACGGAAGGTCCTTCGGCGTTTGAGACAAGGGAGCTCGCTCGAAATCTCC
ATTGAAAAAGTCGCGTGCTGATCGAGCATGAGAAAAAATACTGCGTATCCTCGGGCTTGTGTCGTTGGACGAGCTTGTTGCAGGAGAGCCCGTTCGTAAA
GAGCGTTGTCTGTGAGTTTCCTCCAGTTCATCCACTTCCTTTGATGGTTCAGTGTCAATCCCTTGACGAATTTCGGCAATAATTTCATCGCTGATGACTA
ACTGGTCTGGCTGACAAGATTGATCCGGCTGAGAGGACACAATGAAGTCTTTCATGACCTGGTGGATCGAATCGAGGAAGCCACTTGCCTCCAAAAACTG
GCTGTCCGACTATGCACAACAGATAAAAGTTAAACAAAGATGCCTGGACCAGACAATTACTAAGCCACGAAACATACCGCTTCAAACTCAGAGAGACGCT
CAATCTCGCCTTCCTCGTCCTCATCGTAGAAAAGATCGTCCTGAGTGATGGAGAAAATACTGTCGTTGCTGTCGTTCGAGTTGATTTGATTCAGGCCGAA
ATCTGTAACGTCTTCAATTTAAATGCAGCAACATTATAAGAATCTCAACCCACAGAGCTTATACTTGCTGGCAACGTACCGGAAAAGGAGGACTGAGATC
CAAGAAGTGACGACGAGCTTGATTTCGTATTTAGAGAGCCCTGCTTCATATTCATATTGAAACACAACAGTCGAAAGGTTAGTTCGTGATACCAGTGAAG
TTTACAATACTTGAGAACAGTCGTAGCTTACCTGTGCAGGAATGGGATCTACCCGGAACGAGGACTGCAGGTTGCGCGCTATTTCAGCAAGCTCCATCGC
CTGTTGCTGCAATAAATCGTTTCCAGAACTGCCGTTGGAGTCGAAGATACCTACACCACTGTGCGAGCCCTTGAAACTGGAGGTAAGAGATCCATCCTCA
CTGCTTTCACGTGTCGACGACGAATCTGTGAGGTCGTCCTTGTTCAAGTTCCGTGCCATCTCTGCCAGCTCTGCTGCCTGCTGCTGAATAGACCCGCTCT
CCGTCGCATCATAACAGCTCACCGATGATGCACCCAATGAAGACGTAGGAGATATTGCAGGTGCGGGTTCCAGCTTCAAAGGTACTGACGCTGGCGCTTT
GTCCAGCTTAGGAGATGTTGCACCAGAAACGACTTCCTGTCTAGGAGACAGCGGTGCCTCATCAATACTTGAGTCCTCCGTTTTAACTTCAACTTCCTCT
TGGAAGACCAGAGCATTTTGATCCAAAAACGGTTCCGTTGACTCGTCCACTAGGCTCAGGCTTTGAATGTTCTCGTTTCGTTCTCCCCTCCCACCACGCA
CACCATCTTGCACTTCCTCAGTATCGTCGTTGTCTTCTTCTCCAGTGCTTGGCGTATCATCATCTTCTGAGAGTACATCGGAGATGGCCGACCCTCGAGA
CACCTTGCAAATTTCGATAGCAGTCTCGTCCAGCATCGCATCGAGATTAAGTTCTTCGTCATCCACATAAGTCCGCTTTTCACCTCCAGCTTCTATCTCT
TGCCCCACGTCAACTCCATCTCCCTGTCGTTCCCTATCTTCCTTCTCTTGAGTTTCATTCTCCGTTTCTTTTTCCACGGCACCTCCCTCGAACTTCTCCA
GACGCTTCTGTAGCTCTTCAATCTCCCTCCTCTGCCTCTCTACCACACGCAACGCATCTCGGAGCATATCCGCGTGCTCGGACTCATCTTCAGACATGCG
TTTCCTCCTCCTTTGCTTTGGCGACTGCATGATCCCAATCGACGAGACTGACGTCGACGATGCCGAACTGGACGACCGCGACAGTCTCCTCGCGAGCGCG
AGAGCTGCTTTACCGTCCATACTGTTCTTCCTTTTGGTGTCAGCAGCCTGCCGCAGCTGTTCGATCCACTCCACGCGAGCGTCATGACTCGGCGCGCGGA
ACAACAGCACGCGACCGCTGCTGGACGTGACTTTCCAGCAAGGTCCGCAGTCGTCGCCGACCGTGACCGCGTCTCCGTGGCGGAAGATGCGATCAACAGC
TTTAACCTCCGCGTTTACAAGGGGCACGACGCCGCGCGGCCACTCGCCCAAGTTAGCGTAGTAGAAGAGCGAGTGGGCGTAGACGCCGACGAAGAAGGGC
TCCCAGGGCGACTCGAAGCGCCGACCTTTCTTGTGCAGGATGTGCAGCGTCGTGCGCTTCTCGAGCTCCAGCCCCGTGAGCAGCAGTTCGGGGCATTTCA
CGAGTTCAGGGCGTGCCGGGACGTCCGTCTCGGTCTCCTCGTTGATGGGGATCTGCATGTTGAGCCGCGAGCTGCCACTCTGATCGAATATTGACGAGCG
CAGCGGCATCCGGACGTCACCCGTGCTGAAGACTGTTAAGCTGTCAGAGAGAGCACTGGGCGTGGGTTCTTAGGCGCCTCGCGGCGGAGAGGAATGACAG
TGTGGAGGACGGCAAGTTGTTTTTAGAGTTAGGGCAACGAAAAGGTGCGAGACGAATAGTGCTTGTTCGGCTTTTCTTTGTTTTCGAGTCGTCGGTTCGT
ATCAGAGTCGGGTAGCGATAGAGACGACGAGCTCTTCTGGCCGCCATCACAATACGATGCACATGCCTGCGTGGAAGTCTGCTGCGGAGCTGCTGCTGGC
GGGATAGACACCGCGTCGGAGCTCGTATCGGACGCGCAATGCCCCGTTGCTCGCTGATGGCAGTGAAGCTGAAAGTCTGTGCTTATGTCCTCATACCGGC
GCAGAGGCGCTCCGCTGGCTTGTCCTCGCCGCGTTGGCGTTCCAACGCGAGCGGCCAGAAACTCGCGCCTTTCGTCGACGCTTTACTGCATGGTACAGTA
GTGGTCCAGTCCTTAGTGTTACTGGGCCATGACAGCACTGCTGTGCTGCCGGAATCCCAACAATCGAGGCTCTGACTCTCCGGCTTTTTTATCCGGGCAC
TAACTGCCATGCCAATTCGCGGGCCGATCTTCGGTCATCCGCGCGTCAATGTCCTCTGAGGACATTGACGGCTCCTCTTGGTACGTGTAGCAACGCCAGC
AAGGTGTGGCTTGCGGCAAGTCGCCCGGCATTGGCACTGTTCCACATCCCGTGCAATTGACTGCCTTTCCAAGCAAGTGCGCCTCGAAAAAAAGTTTCGT
GGCATGGAAAGCCAGCTCCAACGCTTGGCAGGCTCACGTCCGCGTCAGTGGAGGCTTCCAGCTCCTTTTCGATATTTGACGAGCGCCTTTCGCATGAATT
CTCGGTGGAGTCCTCAACGATCTCGGCTGCTTGATTACCAGCGAAGACTGAAGACTTTGCTGCTCTCTTTACTAAAGAAGACTCTTCAGTGAAGAGAGCA
ACCCGATTGAACGACGGCGCTGCCAGTGGCTCTGCTATCGGCACAGCAATGGCATACTGGGTTATCAAGCATGGAGCAGCCTCTTTGCTTGTTGGCTGCT
GCTCTCATCCAGTGCAACACTGCGGCTGATACTTTAAAAGGTGATGATAACCTACGCTTGATGTTCCAATTGGCTTGTAGCATGCCGGCGCAACAGTCCC
GGTAGCTTTGCGAGCGAATTGACATGCTGATCAAGTCGAGCATGAGACTGCGTTATCGCTTGAGTCCAGTCGGCGAGTCAAGCGCAGCGGACAGGTAGTT
GAAGTGCGTTCACCCAATGGATGGTGGCAATATGTTCAACCAATGAGCTTGGCTACCCGGAAATTCTACTGTATTTTTGGTCGCGTTGTCTGGTGGTAAA
AGGGTTAGCCCTTTTAGTCCTTAACCCTTAGCCCTAGTACGGTACCTGGAAAATAGTCAAGGACTTTTGTGAAATGGTGTATGGTACCTGGGAAATAGTC
CTCGAATAGTCCTGCATATAATCCGCGTCAGCCACGGTCCGGTTCCGCCGCGGTTCGGGCTCCGGCCATACATCTGTGCAGAGTAAGCGGGACCGGTCCA
GACCGCCTCGTGATGAAGCGGAAAATGCCGTGCGAGCTTTTTCTGTGGCCTCCAGCGCTTGGCTTCCTCCATTCGGCCCTTTGAGCAGCCCAGATCAGCA
GCATCTTACTCCCGTCTCGCCCGGCAGCCATGGTACGTTCCGCCTTGGGAAATGGCTACAGCCCTCGACGCGATCAGGTGCATGAGGGAGTGAATATGAC
GCAGGGGAAAGGAGCATGGGGGAGGACTAAAATCAGCTGCAGCGTCCAGGTGGAAGCGATCGCGATCTTTTGCGAATAGAGACCCTTGCAACACAGCTAG
GATCCCCCCTTCCTCCCTCCCTGCTTCAATAGGAGCCCTCTTTAGTGTCCGATGTCGTTGCGTGCCGGCCGATCTTGTAGAGCCGCTTACAGGTGATTGA
CTAACTCTTTGGTGCTCTCTCACAGTCCAGCAAGAACTTTTTCGCCGCCCTCGACTCGGATGACGAGGACACGCCTCGCGTGAACAAGAAGACCACGCCG
CCGCCGTCGGCCCCCGTGGCTCTGAACAAGCCCGCCGCTGGCAACAAGAAGGCCGGCAACAAGAAGGCCCCTGCCGGCGACAAGAAGGAGGCGCGCGGCC
CGCGTGAGGGCGGCCGTGCTCCGCGTGAGCGTGGCGAGCGTGGCGAGCGTGGCCGTGGCAACCGTGGCCCTCGCCGTGAGTTCGAGCGCCGCAGCGGCAC
GGGCCGTGGCAAGGAGACCAGCAAGCAGGGTGGTGGTGCCCGCAACTGGGGCAACAAGGCCGACCCGAACGAGCAGCTGGCTGAGGCTGCTGCCCAGGAG
GGCGCCAAGCCTGCTTCGGACGAGGAGGCAGCTGCTGAGGAGGCTGCCGTCGAGGAGGAGGAAGAGGAGGAGGTTCAGCTCACCCTCGACGAGTACAAGG
CCAAGCAGCAGTCGTCTCGCTCGGGCGAGCTCTTCGCTGAGGTCGAGGTCCGTCAGGTGACCAACGAGTTCTCCAGCGCCGTGCAGATCACCAAGGAGGG
CAAGACCCCCGACTTCATGGACTCGCAGTACGAGAAGGTCTACAGCAAGAAGACCTCTGGCCGCAAGAAACAGGTCATCACCGACGTGGGTTTCCGCACG
GAGAAGCCGGAGCGTTTCACGCGTGACTTCGACTCGTCGCGCGGCGGACGTGGCGGCCGCGGTGGCCGTGGTGCTCGTGGCAACGGCCGCACTGGTGGCC
GCAGCGGACGTGGCGCCAACGCCCCGAACGTGACGGACATGAGCGCTTTCCCCAGCCTCGGCTAAGGGATCGCGCTGCGACCAACCGGAATCGCGCGCCC
TTGAGCGCCAGCGACATGATGAGTGAGATCTTCCAAAAGAGGGCTTCTCGAGGACTGGTTTGGCTATCTCTTTTTCTCCTTTTCCCCCCACGAAAGATCC
ACCGGATAGGGCCTCTGCGCGGCTGGCTTCTGCCTGACTGTGTGTATCCTCCTGCAGGCAGCCAGCCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGC
GTGAACTCGGTCTTCTCCTTGGTATGTCTATTATTCAATGCAGCAGGCTGGGCTTTATGCGAACGAAAATACCTTTGTTGTTCCTCTGTGCGTTCCCTAT
TTCGTGCTCAACATACACCTGCCTTGGTGTATCTGATACATGACGTCATGTTCTCGTCTACAGACGACGGTCTACCTGTAGCTGTGCACGCACCCGATCT
CGACTCAAGATGATGTCGGTGATGGTGCAACGAGCCGACCGATGAAAAGGTGTTTACCAGTAGTTGTGAGTCTCCCACGCTTGAATATACCAACCTCGAA
AGGAGGTCTCGTTTCAGCGATGAGCTCGCGTTCTTCGTCATCTTCCTCCTCCTCTTCTTGCTCACGACAGAATAGACCACGACCGGACGGAAACCCATGA
ATCCACTTACCGATATACTTCCTTCCGTCCGGAGAAGACCACGACCCATAGCCCTGGATGTCGCCCTTGAACCAGTCACCTTCATACACTTCTCCGGAGG
CGAAGGTGAGTGTACCGATACCATGCCGCTCGCCTGCTTTATACTCCCCAGTGTAGACACTCCCGCACTGGAAGCGATGCACGCCTTGGCCATTCAACTC
GCCATTTAGCCACGTTCCATGCAGAGATCCACCCGCGGACACAAACACGCCCTTACCATGCATCCTGCCTAGATGCCAAGTCCCTTCGTGCGAGTCTCCA
CCAACCCACTCGTACTTGCCAAAGCCTTCGCGCTCGCCTTTCACAAAATAGCCTTCGTACTTGTCTCCAGACGGGAAGACCTTCATACCCCACCCGCTGA
CTTGGTTGTGTCTCCAGCTACCGTCGATCACTTCCCCAGATGAGAAAATCTTCTTGCCTTTGCCATGCATCACCCCTCTTTTCCACGCACCTAGACGAGT
CGCATCGTAAGGGCATCAGCTACTCTGGTGTATGAATCAATGCCTAACAAGTCTTGACATTGCTTCTCACCATCGTAGCTGTCACCATTCTTCCAAAAGA
ACGTGCCGATGCCATGCATCTGCGCGTAATACAATGCAAAGAATTATACTTAGTCCATAACTCTCGTACAACAATAATAACCTCTCAAATAAAAGCATAC
CTTGCCAACACGCCAATTTCCCACGTACTTGTCACCATTGGCCCACAAGTACGTCCCCGTTCCATGGCGGCAGTTCTTTCGGTACATACCTTCGTGGCAG
TCTCCTGTCCCAGCAAAGGTCTGCATGCCAAATCTAGCCCCAAGTCCAGCAACACCATTACTAAATTCATTCTCAAGCCAATCTGACTATGGTTCCGCAC
CCTTCGAAGTCTCCATGCACCCATCCTCCCTCGAAAATATGCCCAGATCTCAATAAATGGACACCAGTGCCATGGCGTCTCTCTTCCTCGTCTACGCCTC
CTTCATAGCGACTTCCGTCCGCGTACTGGATCACGACGGCTCCTCGTGGCTTTTTCCAGCGGATCGACAGAATCTCCAGCTGGTTGTGCTCGTCAGGACT
GGAATTCTCGTCCGACTCGGACTGTGGCGTCGACTCCTGCTTCTTCGTGCGCTCAGCGGCCGTCGGATCTGCTGGGTACGCAGTGCGCGCTCCCCGACGC
CGCCCGCGATTGCCCATTGCGCAGACTTTTTTACTTTTGGGGTTGAAAACTTGAATTGCTTGATTTTTGACCAATAGAACGGAACGAAAGAAACGGAAGG
CGAACTTCCAGCAACGTAAGATGCTCGCAGAGCTTCGTGTATTCCTCGCGCTCGTGTGGTGGCACATTTGCCACTTCCTGGCCTACCACCTGCACGTGCG
CGGTCTCAAACCCACTAGCCAATTCCTCCACAAGGTGGTGATCATTGGGGATGACTTTGCAGCGGGTATTGGAGACTACATCACCATCGGCAGCTCTGGC
GGAGGCATCGCCGCGTATCTTCAGAAGATTGTGACGTTCGAGGACAAGGCAAGTGATGCACTAGCTACAGAGACAGCATAGTTTATCGTGTATAGCTTTA
CATCGGTCCAGCTTAACAATATACTTTCTGTCCTTTACCGCAGGTTCGTCACAACTGGGCCATCATCAACGCAGGAGTGCCTGGATCTACAACGGCGGAC
TGGCTCATGACGTCGCCCAAGAAGGTGCGTGGCTGGTCCTTACTGGTGCTGTTCCTAGCTGAGAATTTGTGATACGTCTTGCCGGTGGGTTAGTACTTCA
AGAACGTGTTCACGTCGAGAGCCATGGGCGACGCGTCTATCGTGATCATCATCCTCGGATCCACGGAGATCAGGTGCATGCAGCAGGAAGGAGCTACTTG
ATGGCTCTTGCATCAACTAACGTCTTACTGATAGAAAATCGGGCGCAGGTGAGCACGAGATGAGGCGGAACCTCATGGAGATCTGTGATACGTTGCGGAA
GAAGGGCAAGCAGGTGTGTTTGGCCACAGTTGCGAGCCCTGACCCAACTGCCACCGAACCAGACAGTGCCAGCTTGACTCTCAACACGGCGCTGGAACAG
TTTTGCAAGAGGTGGGTGGCGTCTGGATCCAAGGAGCAACTCAAGTAGTCAACTAACACACTGCCTTGTTGTGTGCGTTGGGCAGCACGTCGACGGAAGA
GGCACCCGTTATTCTCGGACCACGCCTCGACACGTACGCTTTCCGCCGCGAAAGTGCTCTCTGTTTCGACAAGTACCATTTCAACTCCCAGGTACGGCAG
GTGATCGGAAACGCCGGTTGTTGAGGCAAGATTTGGCTAACCACACGTGTGTTTGTCGTCATGGCTTGCTTCTCCGCACCTTGCAGTCGTACCGACAGCT
AGCTCGTAACACGGCGGATTTCTTGGTCCCCATGATGACCGCTGTGGAATGGACCACCTGGAAAGAACAGCTCAGCAACGTCACTTACGACAAGGCCTTG
TACGACTAGAGCAAGCCACGCGCACTAGCTTTCGCCTGCAGTATCGACCGCACTTCTTCCGCGGCGACTCGCTGGCTGGCTGCTTGCTTGCGTCCGTCCT
CCATCCAGATAAGATAAACATTAACACCCTCAGGAAACACGCGAGCTTTCTTTTTCTTTCGATTTCGGTATTGAGTTGCCACCTTCGCCCTCTCTCTCGC
GAAGTCAAGTGATCTGTTCACTCACACGTGGCCTTCACAAAATGTTCATTTGCCTTTCGCTTCCATGCCATTGATCTACATGTCCACGTCTGCCACGGTT
AATGACAACAACTCGTCATCTTCTCAAGACTCCATAGCGGCATCAGCGCCCGACTCCGCCTCCGCATTGGTGTCAGTTGCGGCGTTGTCTTGTGACGGCT
TGGCAGCCCAATACTCCTCCATCTGACGGTCCAGCTGAGCCGCCTTCGGATCGGGGCCCTTGCCGGCTTCGTGCCAGTACTCGTCCATCTCCATGTCGAG
ATCTTCTCCAGTGGCAGGCTTGGCCTTCGCGTCTCCACGGCCGCGTCCGCCACGACCTCCTCGGCCTCCTCGGCCTCCACGTCCGGCGCCCCTGCCTCCT
TTCTGCTGGTTAGGGGCGTTCTTGTTCTTGTTCTTGTTCTTGATCTGGTTACTCTTGGGCTTGGCTTCCTGCGGCGTGAGCCCCTTCCTGTGCTTGGTGA
CAACCTGCTGGCGCTTGTTGCGGTTGTTCTGCGCGACCTGCTGCAGCTTCTGCTTCTGCTGTTGCTGCTGGATCTGCTTCTTGGTGGGGGCAGGCGCCTT
GCCCTTCTTCTTGCCGCCGGCAACACGCAGAACGGGCTGGATCTTGCCCTTCTTCTGAGAGACCTTGACAACCGTCACCTGGTGCTGCGGCTTCTTCTGC
GCTGGACGCGCCACCGTCTCATCCGCCAGGTGCGTGAAGCGGCTGGACAACGGGACGGCCGACACGCCGATCACGCCGCGCGCCGTCTTCTTGCCCTGCG
GCTGCTTGCTGTTGATCTTGCGCACAGACGCGCGAGGAGCTCCAGATCGCCGATACATTCTGTGGACACTTGGCTTTTGAGAGAATGATCGAAAAAAATT
CTCAAAAAAAACGTTTCTTAAGTTGCGTTAAGGAAAATATTTAAGTTGTTCTAAGGAAATGGATTAAGTTGCTCTATGAATTTTCAAAAACCGACCGAAC
GGGCAAAATGGCCGTGGCCATGGAGGCGGCTCTAGTGAGCCAGGTGCAGCGCTACCTGGACGCTTATGTGTACGAGAACGCGCGGTTTCTAGCAGAGCGA
CTCGTCGCGCATGTATGTGTAGCTTTTCGGTGGATTTTGGAGCTGTAGAAGCTGAGCTACAGCTGTTTGAACCAAAGTATCATTGCGCTTTTGACACTTT
TCATGGTTTCTGATAGCACCCGAGTGAAGAGAACATGTTACTACTGGCCACGTGCTACTACCGGAACGGACAAGCAGCTAGAGCAGCGGAGGTGCTAAGC
GGTGCAACCCGGCCCGAGAACCGCTACCTCTTGGCGTGCTGCAGCTTTCAACAAGGACAGTTGGTTGAGGCGGAGAATGCGCTGCTGGGCGGAGAGAACT
GCCATATTGACGACTTGGAGGCAATAGAGAACGTGCCAGCGGGAGCTGCTGGATTGTATCTGCTTGGTCGAGTCTACAGACGTGGAAATCGGAGGCAGCA
AGCTGAGGTTTGCTTTGTGAAAAGGTACTGCGAAAATGGAGCTTGCCTCTGGTTGAGGATGGGAGTTTTGACCTTGTGGCTTGTACTTTGGTGTTGCTAC
TAGTTTGGAGATCGACCCGTTCATGTGGTCGGCGTATGAGCAACTTTGTGAGCTTGGAGCTAACCTCGAAGCCTCCAGTTTCTTTGGTGCAGCGAACTAC
TTTAACAGCACTGGATCAGCTGATACGAAGGACTTTGGCTCCAGCCCAGAGTTTGGTGGACAACAGTTTGCAGATTATGATGAGTCTAACAATCTGGAAG
GTCGATCTACGGACGGGGCCTTGGCGACACCGGAACAACCAGCGGGTTTCGGCCTCGATACGCCGAAGAGCGTATTAACGTCAGGGTTGCGAAGCTCAAG
ACCGCTGGCATACAAAACCCCGAACGTGAATACGAACAACGCAAGCAACATCCACACTGCGACTGTTGTGAAGAAACCGCGGGTAGAGGACATTGGAGCT
CCTGCGCGACAGCGGAAAGCTCACCGAAGGCCTCTTACAGATACCGACGACAAGCACCGACCTAATGCAAGACTGTCGTTCTCTGCTGCTGGATTTGACA
ATTCACCACTGGTATGTTAAGAAGCTCACTGTTTGTGCCCTGGTTTTGACTTACTAACTTGCTATCCTGTGTTGTAGAACCCATCGAGATTGTCGCTAGG
CTCTCCGACGTCCCCGCTGCTGACGAGGCGTTTTTTTCAGGACAAGACGCCAGTCCATACAGAAGCGCCTTCACATCACGTTGATAGTCGGCATGAAGTC
CTCCGTTTGCTTAGTTCATTTGGCTCTATTTATCAAAAAATCAGTGGGTACAAGTGTCGAGAGGCTTTGGAGATGCTGGAGCGGCTTCCTGACTCGCAAC
GTGCATCCGGTTGGGCGCAGCAACAGATCGGGCGAGCACATTTCGAAATGGCCGACTACGTGCGCGCTCAAGAAGTTTTCTGCGCCTTGCACAGAGCGGA
ACCCCATCGAATGGAAGGGCTCGACCTGTACTCAACGACATTGTGGCATCTGAAGAAAGAGGTGGAGCTTTCGTATCTCGCGCAGCAAGCTACAGAATTC
GATAAGCTTTCGTGCGAGGCTTGGTGTGTTGCCGGCAACTGTTTCAGCCTGCAGAAAGAACATGACACAGCGCTGGCCTTCTTCCAGCGGGTAAGTTAAA
CCTGTAAACTGTGTTGAAAAATGCTTCTGAATAACGCTTCTTTGTTAAATCTGCAGGCCATCCAACTGGACCCGTCGTTCACATACGCGTACACCCTCTC
CGGTCACGAGTACGTTGCAAATGAAGATTTTGAGAAGGCGGTGAACTGCTACCGACACGCCATTCGAACGGATTCACGGCACTACAACGCTTGGTATGGA
CTGGGAACGATCTACTACCGGCAGGAGAAGTTCGAGTTCGCTGAGTATCACTTCAAGCGCGCTCTGGAGATCAATCCTCGGAGTTCCCTGTTGCACTGCT
TCCTGGGGATGGTTTTACACGCCACCCACCGATACGACGAAGCTCTGGACACTCTTGCCGTCGCCGCCGAGCTGCAGCCGTTGAACCCTCAAGCCCGTTT
CCAGCGTGCGAACGTGTTGATCACTCTGCAGCGATACGATGAGGCTCTGGACGAGCTGAAAGTCGTCAAGAACTTTGCGCCGCGTGAATCTTCCGTGCAT
TTCCTGATGGGCAAAGTGGCCAAGAAGCTCGGGCGGATCGAGGAGGCGATGAAGCATTTCACCTTAGCACTGCACTTCCACCCCAAGGACAACAACCAGA
TCAAGATCGCCATCGACAAGATCAACGAACCCGATCACGACGACGACGACCGCATGTAGCAGCAAACTCCCCCCATATAACATAAATATGAGCTGAGACC
ATCCATCATTGACCGTTTTTGTATGGGCATTTCTCTTCGTTCGACTATGACGCCGGATATGAAAGCCGACGCGCGGCTACTGCTGCACCAGCTCACACAG
TTCCAGGACGCCAGTGAGGCGCTCACCCGCTTGTTCGACGGGTTAAATGCCGCCGTGTTGCTGCAGTTGCTGCATTGGCAAAACACGCCAGCGTCCAGAG
GTCTCGTGAACGTACTGGAAGACCTGGAAGCCAGCGGTAACGATGTCCAGCCAACGGTGCGCAGTGACATGGAGCTGACAGTGCTGGGGAAGCCTGCACT
GCTGTTCGCCACGTCCATCTACGACGAGGAGCTGGCCATGTTGATCTGGTCGGGCTTTCTTCAATTCCACAAGCTGTATCCGACGTTCGACCTGACGCGG
CAGGTGCTGGACAACTCCGCGGACTCACTTGGATACTCTGCTCTGCACTATGCAGTGGAGGCCCAGATGGGCGAGTTCCTACGTGCAGTATGCAAGGAGC
TCGAGAGCGACAAGACGGCGCCAGTGGCTGCTCGAGTGGTGACTCAAGACGTGACGTTGCCAGTGAACACGGCGCAGAACATGGGCAAGAACATCGCTAG
TGGAGGCTGTTCCCTACTGCATCTTGCAGCCAAGAAGGGCGAATTGGACATGGTGAAGCTGTTCGTGGTGTCCCCAATGCTACTGGAGCCTCAAACTCTG
CGGGATTGGGACGGCAACTCACCAGCTCGAGTGGCAGCCATTCATGGTCACCATCAAGTCGCTGCGTTCTTGGAGGTAAAGCTAGAACTTTATGGTTGAT
GGTTTGATGATCTAACGAGTAAGTTCCTAGGGTATCACTGGTGACGTGTCATTAAGCGCTTCGGAAGTTGAGGAACTACGAGCCAAACGCGAAAAAATGG
CGAGAGAGCGCTACCTCGCGCACTTGAAACCTCATGAATCCATGCTGGAGCCGTCCGTGTTTCAAGGTATCTGGACACTAGAGGAGACGACGCTCGTTCG
GAACGAAGTGAACCGATTAGCTGCTGAGCAAGGCTGGTGCAAGGAGCGTCACGCTTCGTACCAGACAACGGACATGCCCTGTCACCAGGTCGCTGCTTTG
AACTCGTGGGTACGTTCGACTTTAGCTGCCAGACTCTTCCCTGAAATCGCAAAGCGGTACAATCTGCCCAAGACGAAGCGACTGCTGTTCCGGGACCTCT
TCTTCGTCAAGTACGAGGCGCGGAAGGGCGAACGCTCGGAGCTGGCACTTCATCGAGATGGATCCGTTTTGTCCTTTAATGTGCTGCTGAACTCGGCTGA
AGAGTTTACTGGGGGCGGCACCTACTTTGACGCCACGAAGCGTACTGTCCACATTGCAGAAGGTGACGCTGCAGTTCATAGTGGAAAAGTTCTTCACGCT
GGAGCGCCGGTGCTGTCAGGTATTCGGCAGATTCTTGTGGGCTTCCTGGACGTCGCGGACTGCGTGTATTGAGATCACAAGCGATGGAACTGGATGCCCT
CGATGGGTGTGTCCCCCTCCAGCACATATAGTCGTGGACACCAGTGCTTTTCGTCGTAGATTTCGTCATCGAGAGACGTCTGGATAGAAAGTGTTGCCTT
TGCCTGAGTAAAGGTGTTAGTTGGCACAATGAGCCAAACTTGATAGACTGCAACTTTTGGCATCCGTACCCGCTCAAGCTCGAAAAAGAGGATGCGATCT
TCCCAAACCTTGTCGTACGTGTTCCCCATCATCTACAGTAATACGACAACGACAGCGTTAGTTGGCTCACTATTTAAACTGCAAACAAGTGTGAGATCGT
ACGGCAATCAGGAGATTTAGTAACATGATGGTACCAATAACCACAAAGGCCAGAAAGAGAAGAATGGCAAGTAAACCGCCTTCGTAGATACTGTCCCAAT
CCCACGAGCCTAAGCTGATGTTGAACGTCGTTGTGACAGCTGAAAAGTAGTTCTTGCATCCTTCAAGCTGCAAGGCGAACGCAATGTCAAATTGATAGTG
CCAATATTTTATCACAGTGTTTCACGTACCTGTAAAATGAAAAAGGCAAATGCAAAACCGAACAGGAATACGCAAAACACCATGACGAAGACCAGAATAT
CCGAGAACATCTACAAAACAACAGTAAGAGTGAGTACGGCGTATACTAAAGCTTCTGAATGTGCACACACCTTTGCAATCATGCGAACAAAGGGCCCAAG
GGCACGTGTTCCTCGAGCGAACTGAATCCACTTGACGAAGATCTGCGGCCCCACGATGCTCATTAAAGTGATGCGGAAATTGTATCTCCTGCGGATGTTG
AAGCTGTACAGCGATTCTTGATACACAATGAGTCTGAAGTCGTTCTGGTCAAAGTCTAACCAAGAGTTGTCAAAACCAGTATTCCCCTGCAAATTATCAG
TTCACGCACATGTACCTGGGGATACCATTTCGAGAACTTCTGCGACCAGCAACAGCCACACACACGAGATCTGAACTAGGTCGAACCAGTTCCAACCATC
TCGGAGATACAGGCGCAGACTCCCGCAGTCTCTATACGCTTGGTACTGTAAAAAACACACACACAAAGTTGGCAAGAGATTGCTTGCAGTATAAAGTACC
TACGATACCTCTTGGAGAGTGTACATGGCGTTGATAACGGAGTAAATGAGGCGCGCGACGTCGCGAACGTATTCCATGGCTCCGACGTCCTCGTTGAAAA
TATTATTGCGATATCCTCCAAGCGGCATGCCAACAAATGTGTCGCCAATGTGCAAGTACCTACACAGAAGGCGAGTGTCCATATTTTAACTTTCAGGTAG
CGGTACAAATAATACTTTAAGTACTACGTACGTGGCCACAAACACTGCAACAAAGTACACGAAGTACACCTTAAACTCATAACGAAATGTCTGTTTAGTG
AAGGAGTTCCATCTAAAAGCGAAAAAAAAAATTAGCGTCAATACAAAAATTCCCCGTAAGAGAACGTACTTGTGGTCTAACAGTTGCCGAAACCACGGGT
GGAAAATGAGATCTTTGCATTCGGTCTGTTATCATACAGTGATCGTGTTAGTATAGAAAGCAAAACAGAACAATCCAAGCAGATCCACGTACCTGGATAA
TCAGCCACAGAGTTGGGCTGTGCCGACTTCGAAACTCCGCGTGGTCGTACACGTACTCGTACAAAATTCCTTTTGGCTCGCAAACAATTGTATCCTTCTG
CCTGTCTTCGTCTTCCGTAACTGTAAATACGTGTTGGACGCTCAGCACGTTTCTCACGCGACGTAGGAACTTCCAGACTTTCTTCAAAAGTTTCAGAAGG
CGAGAAACAGCCCTTGCGAGTGATCCCTGCTTGCGCCTTCGTCGTGGCGAACGCCCACCTTTGCCTTTCATCTGCACTGTCAACGCATCTCTCTTCTCGC
GGTACGTTTTCAGTTGGTTGCTCACAGTCCAACGTTGGTTGCGCTCGCGAACGTGCTTTTGCATACTACATCGGAACAGTGGGTTGCGAAAGGAATCCAT
CGCCAAGACGGCAGCTTCAGGGACATTCTGGATCAACAGGTGAAACAGTTTGCTCCTCTCATGGAGCTCTCGTACTTTATTGAGCTCGGAAGGAGCCACG
TGCTCTGAGACGACAAGAACCCCAAGCGTTTTCGGGGGTAGAATTGAATACCCCGGCGCCGACCGGAAGAATACAATGTCGCGGCGATTTCGAGTGCACA
GAAACGGAGAAGCCAATAACGTATCAACTGTTGAGCACGCACTGTCATTCGTCGTCCCGACAGCATCGTGTCGAACATTCGCTCGTCCTGGAACAATTTC
AGGTGATACCGCAGCAGTACCTCCTGCTAGTGTTTGATACTGCGGTAGATGGGTCTTGCTGTCCGGTGGACGCTTTTGCTGCACCATAGCCCCCGAGCGA
AAGTTCAGGGACGGCAGCAACTTGGCCATTGCCTTACCGTCGGGAGAGTCCACAAATGTCCCTCGCAGGACTGTACCGTTCAGTGTCGAGAAAGTTACGT
ACCGAGAAATCCTCACATCCGCGTGGTTTTCCACAAAATGAAGACAAACTCCGTGACGTTGGCTTGCTATAGCAAAATGAAGTCTGCAGAATAGTGACAA
GTTGGTAAGTGATTTGCCAGTACGACAGCCACAGCACCACGTACGGAGTTTCTCCTGACTTGTTCTGGGCGTTGATATTTGCTCCATTTGCCAGCAGGAG
CTTGGACAGCGTGAGATGCCCGCCTTCCGCAGCGTAATGAAGTGGCGTGTTACCTGCCGCGTCTCTCGAAAGAACGAGCGGATGACCACAGATTTGAAGA
AGATCCTGCAGCGTTATCGCTTCATCATGTAGCTTGTCGAGGGAATCCGAGAATCGAGCGAACGAGACACCGACGTCTGCTATAAGAGCTCGCATTTCAG
CGTCCGACTCGCTTACAAGTCTCTTAGTCTTGCGCATTTCCAGAACGAGCTCCAGTAGATGACTCAGCTGCATGAAGCTGTACTTTTGATACGGAGAATT
CATCGGGTACTCATTCCAATGCATGATCAGCTCGTTAACCAGGTCCGTGTATCCACGTTGCGCTGCAGCGTGCATGACCGTGTATCTGAATAGAAGAAAA
CCATTAGCATTAGCTTACTCGGAGAATATCATCAAACGTACTGGTCTAAACCGTGTGGCTGTAGGAGATCCAGACCGTCATTCGCTTCGTTCTGCAAGAT
CCGAAGTATTTTAGGCAGATTGGGCTCTGCAAGTCGGAGAACACCGCTCTCCGTTGTCATTGGACCGGGTACAAGAGGTCTGCACTTGCAGCATTCGTCG
AAGAGCAGCTTGCTCTGCAGAGCGAGGTGCTGCTCGTCTCGGTTCTCGAGTAGTAGGTGCATCCGGTAGTATCTCCGCATTGCACGGTTGATCTTCGCTG
CCGCCCAACCCTCCGGGCGTTCGCTGGCATTGCGGAATAGGAACCTTTTCAAGTAGTTTCCTCCCTGCAAGAGGCGAGTTGGACTCTCCTTCTTCCTCTG
TGGGTTACGGTGGGGATGGACATGCTGCGCTCGAAGTGGCTCCTGTCGTAGGTGGAGGCGTGGAGGCCGCCTCCGAACGTCTTCCAGGATCACTTGCTTG
TGTTGCTTCTTCTTGGTCGCTCTGGTCTCCTACTGTAAGAGGTTAGTACAGCACCCAGATGCACAGTATACACATTGTACTGTACCTTTATATGCGCTCG
GTACGCCTCTAGAACTTCATCACGCGTGGTTGGAGCGCCTGGGGGCACCATGGGCGCAGCATAGCGCCTCGCTGTATCTGGCACCATCTATATGCCCGTT
CACGTTGAAGTGGTTTTATAAGTTATAACAGTTACAAACAAAGCATATTGTATACACTTAATTTTTGTGTTCGGTATACACCCGCAAATATGATATCAAT
AATTGCACATCTTTTGTGCCATTATTGTCATAGCAGTTGCTGCGTCCATGGAGACCATGGACGGCGCCTTCTTCTCGTTCCCGTACGAGCCGTACTCGAT
CCAGCTGGACCTGATGCGGCAGATCTGGGAAACACTGGAGCAAGGGCATTGCGGCATCTTCGAGAGTCCGACAGGCACGGGCAAGTCCATCAGTCTCATC
TGCGGGACGCTTACATGGCTGGCACACCACACTGACGAGTTCGGACTGCTGCAAGGCGCTGCAAAGGCTGACACAACGTCCACAGTAGCTCCTGATACCA
AAAAGAGTGCGGAACCGAGCTGGTTGGACGACTTCGAGCAGAAGACGGCAGATCGAGAAGTCAAGTTCCGCCAGCAAGTGGTGAAGGAGGCGCTGGCTGG
CATCGAGAAGCTCCGACTGGAGCCTGAAGCTTCCACGAAGAAACGGAAAATGGGGATCGCCTATAACCACAACGGACGGAAGCGGTTGCACCAAACAGGA
AGAAGAGAGGGCAAGCAGGATGAAGAGGAAGGAGAGGAACATTTGGTGGATCCGTACGACAGTGATCGAGTGGCTCGTCGCAATAGCGAGAGTGACGACG
AGAGTGGAGAGAAGTCAAAAGGACGCTTTGGCGAGGAAAAGTCGGACTTTGGCGTCGTGAAGATCATTTACTGCAGTCGAACGCACTCGCAGATCTCGCA
GTTTGTCCGAGAGATACGCAAAACTGTGTTTGCGGAGCGTATCCGAGTTGTATCTCTGGGTTCTCGCAAGAATCTGTGCGTCAACCCGAAGGTTACGAAG
CTCAACTCGGATTTAAGAATGACCGACAAGTGTCTGGATAT