Description :
From Genome Similarity Track
Location :
Scaffold_2277:416- 2817
Transcript NameFunction/comments
Phyag_g12289hypothetical protein PHYSODRAFT_543861

Sequence
2401 bases(100 bases per row)
TGGGAACCGAAGGCTTCGCGACGAACGTGCACCGGCCACTAGGCGAAGAAGAGATCGAGAACAACTATTTCGGAcagcagaagctcatggAGGGTGCTCT
CATCAAGCTGGGTGACTACGCTCACCATCGGTACTTTCAACTTTTCCGCAATGGGCGCTTCTGCTACTATGAGttgccaacaccagcagtgACGGCTCAT
GGAGTCCGACGGGTTCACCTCACGTCGAAGCATCTGCGCGGCATCATGTTGCTCAAAGCATCCAAGGGACTGGTCAAAAACGACGAAGAGTACGAGGCCG
ATCTCCTCAAGCGAGGACTTGTATTTAATCGCAAACGACTGGAGATGCAACTCACGGGGTACTCGCCTGCGGGACAACTATTATCGTGGAAGCTACGCGC
CAGTAAGGACGCCGTTTATCTCAAGTGGGAGCGCGCGTTCCGCCTCGCCTTAAGACCTGTGTGGGTACAAAACTCGAAACATTGCAGGGTCTGCAAGAAT
GACTTTGGCTTCTTCACCCGCCCACACCACTGCCGGTAGATGCTGTGAACTTTGACATCGTGTAGCCTATTGCTTATTGACCATGATTTTTGTGCGTGTA
GCAAGTGCGGGACGTGCATGTGCGACGGATGCTCGGTGTTCGCCCCGCGACTGCCCTTGCAAGGCTACTACGATGAAGTGCGCATTTGCCGAGACTGTTT
GCCTATCAATATCCAGGTTTCATCGTTGAAACACGGCACACAAGTTTTAGTCTACGGTATGCTTGTTGGccgcgtcgtggtggtggatgctGCAGAGGGT
GCGGAGGACGGAAAAGCGTACGTCATCGTGGAACTACTCAAAAATAAGCAAGTGCGGCGTTTTGCTCTGGAACGCCTGGAACTCTACTCGACCGCAGTAC
TGTCGGCAAACCGTATCAAAAGCGCGATGCGCCAGCATCTTTCATATTCACTCTTTCGTACCCGACTCAATTTCAGCACGTCGAACATGTTGGAAGCGGT
ACAGGAGCAGCGCATAACCCAGATGATGCGGTTTGTCAAAACGTCGATCAGTATCAGCGACCTGCGCTCGATGATGCCGCTTCTCAGCGCTCTAAACTCG
TTGCAATTTGCCGACGGTGCATTTCCGGAGAAGGAACGAGTTAGAGCTTCTCTTGCTGACTACCGCGGCGTGAGAGTGTTGTTTCCTCTGCGTCTCAACA
CTGTCAAACGGCTGATAAACCAGTTCCGCAACGGGATATTGCTGCACCCAGTCTTCGTGCGTCGGATCCTAGATGAAAGTGCAAAATTGTTTCGAAGGCT
GCACCAGTCACCTATGAATTCGATCGAAATCCCGCCGGGTGTGAAAATGGTTGTTGTGGGCGATCTGCATGGGCAGCTCGAAGATTTACTGACGATTATG
GAGAAAAATGGTGTgccgagcagcaaaatgtgGTACCTATTCAATGGTGATTTCGTGGATCGCGGAGCCCATGGGGTCGAAGTgatgcttctgctgctgg
cattcAAGCTGTTGTATCCCGAATTTGTATTTCTGAACCGTGGCAACCACGAAGAACGTATGATCAACGAAATTTTCGGATTCCAAGACGAAGTGTACTC
CAAATACGGAaccaacgacgacagcagcactcgtTGGGGTGGACTGGGCTCCTCCGTCAATTACTCGGCGATAAAGCTCTTTCAAATGTTCGAGACGGTC
TTCAGTTTGTTTCCAGTGTTCGCGTTAGTCAACAGGAGTGTCTTCGTTGTCCACGGTGGATTGAGCAACCACACGGATGTCACGATTGCAGAACTACTCC
AGTTAGATCACCTCGGCGAACCAACACAGGGTACGAGCCGTgccgacgagctgctcatgcATCTTTTGTGGAGTGATCCGTGTGATGAAAACGGATGGAA
GCCCTCTAATCGCGGAGCTGGAGTGGAATTTGGCCCGGATATCACCAAGGCGTTCTGCAAGCGCAATGAGATTAGTCTCATTATCCGGTCGCATGAATGT
CGAGAAGAAGGTTACGATATCGTTCATGACGGTCTCCTTTTGACCGTATTTTCGGCGTCGAGCTACTGTGGCTCTCAAACCAACAAAGGTGCCTATGTTC
TTTTGGAACGGGGAGAAAACAACGATGTCCAGCCGCATGTGATACAGTTTACATCGCGACCGCTTCAACAGCTGAAAGCCGCAGGGAAGAACGAGTGGCG
AAAGAAGGCTCAGCGTTTGGAGTGGCAAACTTTGGAATCGCTCTTGAAGATCATTTGTGAAAACTATTATGCACTACAGTTGGCGTTCGAGGAGTCGGAT
GCTACGAGCTGTGGGACCATAACGAAGATTGAGTGGAAGGCCATCCTGCAGAGAGTTTTGGGAATTGAAGCCAACTTCCTCTCGTACTTTCATCAACTAG
C