Description :
From Genome Similarity Track
Location :
Scaffold_72:41597- 49530
Sequence
7933 bases(100 bases per row)
TTGCTACTGCACTCAAGGTGATCAATCGCTTAAATTATTTACCTTCCTCTGGGACGTAGAAGAAGGACTATCCAATTTGCACACTTTATTGGTCACATAT
TATTTCCTCATTTAGAAATGTATGCAGCTGAGTTTCGATACCAAAAAATGTGTTATACATTAAAAAATGGACCAACAGCGACACATTGGGTCACCCTGGT
CCAGCTGGTCCGGGCAACGGGTCGGGGACTGACCCGGGCCAATGGCCCTGGGTCGGAGCCCTAGTAGCGAATACCTAGTTACAGATAAACCTACCCAATT
TGATATTATCCATAGAATGCAATTGTATTACATATAACAAGTTATCAGATGTTAGAGGTGCGAGCGCTCTCCAGTCACACTCGCAGCCCTCAAAACTAGC
AATGGAGCCCGACTTTGTGTTTAGTAGCTCATTCCAGTATTCCAGCTATAGCTCTTCCTCACTCTCCTTTGCCGCGTAACAACGATGCCGTCGAGACCGC
GTCAGGTTAGCAACCTGACTTATAAACAGAAGAAGAAGGGTTTCCAGTAGCATGACGCAAACGCCGCTCTCAAACAGTCGCATCTAGTAGAAATAGCTCA
GTGCCAGCTCTGTATCTTCAAGACGCAGAATGTCGGAGTTTCTGTTTGTGGAGGATGTCAACCTCAAGAGCAAGTGGACGCGAGCGCTTGCATTCCGTGA
ATTCAATCAGGTCCTTGCGAATTTTAAGCCAATCGCGTGATGTGGAGAGGTGATAAGATCAAGTCGAGAGTGATGCTGTTTGCCATATTGATCCGAATCG
AGGACGACCAGCTACTGTCACTTTTAAGCGGGTGGCTACAGGAGTTCCAAGGACGCCACGGCTTCAAGCAACTTAGCAGCCACGGTCAGAGCGCCTTCGT
AAGCTCGATGGGGATGTGCAACCCGAAGCCATCCGGGAGCGCTAGAAATATATGGCATCGGCAAAAAGAGACTGCTTTACTGCCTCGCACCCCATAGGGC
TATAGCCCAACGAAAATTAAATGGATTATCAAGAATCGTGTGACGGTCGCTCTGATGTACAACGCTGACGGTTCGTAAAAACGTGAGCAGTTCATTGTTG
GTCACGCAAATAATTCGCGCTGTTACAGAAGAGGACAGAAAGTCAATTTGGCTTCTAATATCGCAGCAGCCTCAAGGCGTGGATGACTGATTTCCTGTTC
CGATAGTGGTTAGAAGAGCTTTATAACGATATGTGCATTCAAAAATGCACCACTGTTCTCCTCCTCGACAATTCATCGTCGCTAACAGCTCATAACATGA
AGCTGAAGAGAGTGACAGTAGTGACCTTCCGTCAAACACTACTTCAAAGATCCATCTTGTTGATGATGGTATTATTGCCTTGTTCGGGCGTCAATACCGG
CACATCCGGTTCGAGCACGCTTTGGATATGGAGAAACAAGGATCGCGGACCAGCATCTACAATGCTGGCTCAGCTCACGTCGATGTGGATCAAATCCTTC
TGGCTTGAATTTAGGGCGATACTATTCAGTACTGCTCTCGGCACACATGGAACCTTTTTGGTAGTACAACCACTAGCAGATCATGCATAGACGCCGTAAT
TAAGCTATCACCATCCTGCTGGCACAAATGCTTCAGCTCATGGACCTGAACAATTTCATTTGCTTCACTGTCGAGTCTGAAACTAATATGGAAGCGCTGA
ATGCCACAGCCCTTCCCAGCGAGGTTTTGAGCACTGGTTTTTGTATACGCCTCAATGTAGCACCGACATTACGAAGTCACAGTTCAGAAGCGAAGGCGTC
ATCAACGCGCAGACAGAGGTCAGCACCGAGGGATAAATAGACGTAGTTTGATCCATCATTTTTTCTCTAGGTGAATATCCAGTTCTAGATCGGCTTGTCA
TGGGAGGGATGCGTACAGTACAGTAGGATTGCGGAGATGAGGGTAGAAAAGTAAAACGTAATCACATACATACGCTGATTCGTAAATACTTTTCTGCGTC
ATCAGCCGTGCAATATTGACGACACGATAATGAAGCGATCTTGATAGCACGTTTAATAATTTTCGTCGTTTAACGTGTTAACTCAGATTGATCACGATTT
CCGCATGCGCGATGTGCATCTATGACCGCTGACACATTCGACCCACGGTTCACAGCCTACCATATAACCTCTGACATAAGTACATCTACTTTGTACACGA
TCATAACATGTAATTGGCTCCGTTAAACGGTTCCACTTCAACACGGGGTCGACGCTTGGTCGCATAACCTAATATCAGAGAGCGCAGAACGCGGGGATCG
GATTTCTGGTTAAACCACTACATCCAGATGCAAACCGTTTTATGTGTCTAAGATTTCTAACAATTCTTATGCTTTCCCAGGATAGTGTCCTTTCAGGTCC
CATCGTTTGTCATAGTCGCACTCCCTTTCCATCTGATGTGACTCTTTTTCTCATTTTATCTGATGGGGTCCATCATTAAAATCGGGGATGTCACTGGCTG
ACATACAGTGCTGGCATGTTCCGGAGCCCCACGCATCAGGATCCGACGGTGTAAATATATCACATTTGAGTTTCTGGTAACCGACCCAATGATTAATGGG
ATGATACTGCCACAGCAACCCTTTCAAGCCAATAAGCGTAATTAAAATGAGGAGTATTATGTCATAATTGTATGTACCTACGTGGAAAATACACTCGCAC
ATCTGTGTAGCCGCACCACCTAAAGCCAATTGAACGTACCCAAATATATAGCTATCAAACCATTTCCAACAATGATATATTTGTGAACCGCACGAGGGCG
GAAATCAAAGCCTTTTAAGTTTTCGGGGGGGGGTAATTGTTCACGCCACTTATTAAAACAACAATCCAGGAAATATCAAATTCTTACAAGCTTATTGATC
TATCGTCACTTTTGCCTATTACCAACTATACGCAATACATTAAAATAAAAACGGAATAGGTGAATCAACAAGTAAATCGCAATACCAGCACCAACCAAAT
GCAAACATTGCAAAACCCGCACCAGTAGCAAAACCAGCACAACTGCAGGACGGAATTAATGTGTACCACGCTAAACCCAACCAAATCTTTATCATGATAA
TATCTCAATATTAGCAGTAGGCAAACAAAATAGTCCGCTCCCCCCGCCCCTTCTCATGGGCACCCACCTTCGGCGGAGATCGTCTCTTCCTCGACCCCGA
ACTTTATGAGGGATGTCTCGGTCAGGCTTCTTGTGCGGTCGCAGGATATGAGAAAAGGAGGCCGGGAGGGGGAGAAACACAAAAAATGACGTTAGGCCAT
CAATCTGTTGTCTAAGTTGGATTTTTACGTTGAAACATGCAACATGTAACAGTGCGGCATTCGTGAATAATCATACCTCATAATCAGGAGCTACTCAATC
CAAACTTATTAAAGCCGAATGTACCGCAATTATGAGATCTAACTGATGTGCTAAGCTATCGTTACTGTTCTTACATTATTCGATAGACGTGTGTGTGAAA
CAAGAATGTTGTGTGTATTCGTGTATATACTCATGTCAACTACTTTTTCTTTGTATCATGAGTACATGATCCACGGCTGGCCACGTGCCTCGCCACAATG
GGACGCTTCGACGGTCGTGTGAGCGCGTTTGACGGGCCGTAGAATATGTGAATGGTACCACACATCACGGCCGGCGTCGTTGCTGCAGCGACCGTGCGCT
CAAGAACAGTAAGTGTCTTGCATGTTCCGTAAACACCAATTCATGGAGACAAAGGCAGTGCTATTGTACAGCAGCATAGCATGACCATTTTTCCGTTGCC
GCCGACGTAATTAGCATTGTATAATCACCAGATATATAGAGCACCGGATTTTTTATCTAGGCTTAGACAACAACAGATATCGGTCAGCGTTTGCATGTTC
AACAGACACGGAATACTATTTCTACAAAGTTTTAACCATCATGTTTATTGATGTGATGTCGCGATGAGCTATGGACTGCAGCTTTAGATTAGTAATACGG
AAATTTATCCTCGCTTGCAGACTTCGTTCGGAATGATGTCGGGCACGGCGGTCCCTGTCGTGACAAATGGCAGCACCATCGATGAATCATACACATTCCT
CAGGTGAAATATTTTTTGCAGCGACTTTTTCGTTGTAATGGACAGCACCAGTTTAGCGGCACCATGAACCCGCCTAAGTCGAGTGCTGCCATTTCGTCGG
ACATCTTGATGCAATGATATTATTTATTCTTTGTCAGTTCTACTCTTGGCACCTGGAGACTTAGTTTAATCAGTCATCCATAGAATAGCGTGGTACACAT
TAATTCTATCACGAAGTGGTGCTGGATATGCGACTTGTGCAGATTTTGCCGTGTTGCATTTGGTTGGTGCTGGTTTTGCGATTGACTCTGGATCAACACC
GTATCAGATATAACAAGATATCATGTGGAATCAGATCAGCCAGGTTTATCTGTCCATACCTTGAAATCTCCGACCTCCGACGCGCTCCGACCGGGATAAA
GACAGTACTAAATTGTGTAATTGTGTGTTAATTATTATAAGTGGATGGGGGGGCTTAAAATATGATAAATTGCGACAAATTGATTGTACTCGATTGACTC
AGGTGCCTTGCACGACATGTTCATGTGTTCGTGCTCGAATCTGGTATCTACGTGGTGATCTGCTTCACTTCATCGGGAGTAGTGCCAACGTGTTGATCTA
CTACGACATGCGGACTGTGGACGAGCTATACATGAAAGTGCTTCAATGTATACGTACGTGCACAAGTGTCCATGTATATCCACACGCACGAAGATTGACT
GCGAATGGATCGTTATGTTGTATTCAATGAAAGGTTTGTAAACAGCTACGTGTTGGACAACCTGTCGCCCAGGTGATGTCCGGACGACCTGTTCACCTGT
GCTTAAGTGGTGTACAACACGTTTGCTGCGTACGTGCACATGTGTTCATGTCTATTCACACGCACGAAGCTTGACTGCAAATTGATCGTTATGTTGTATT
CGATGATAGGTACATGGTGGACTACCTGCCGCCCAAATGCTATCCGGACGACCTGTTTTCCCGTGCGTAAATGGTGTACAGCGCATTTGCTGGGTACGAC
AACGCGCTGGGCATCAGTGTTGGTAACGAGAACAACCTGCAGATAGAGAATGGTGCCGATGGCACTGCGACGGCACCATGTGTCAAGTATCTTTACGTGA
CACACGTAGTTACGCTACGAACTGCTCGGGGTCCATGTGTCAGGTGCCCATCGGTCTCGACATTCCGCCTCGCGAGCAGTGGATGGTGTAATACGATTTC
TTAGTCGATGACGATGAGAATACGCGTGCTTTAGGTATGACGAGTTAATAGTTGATGGAGACTTTTCAGTGGATGCTGTGACTGAAGTGGATGTAGTGGG
TAGATAGGTGGATGGGTGGGAGATTGATCACTATGTGTAACAATCTTTTTGTGGCTGCTTGAACAGGATGGGCTTCAACCCGTACGTCAAGTGCGATCAA
ACGACCGACGTCAAGTACTCGCATCCTTCCAGGCTGAAGAAGCTCATGTCGGTGTACGCGAAAGTCGGCTATTCTCTTCCGATCATGTGTGGAGAGTTTG
TTTGCGACAAGTGCGTGAAAAATATTGACTGCTCGGGAACCAGCGTATGTTCTACAATGTAAGGAGCGAGAAGAGGGAAAGTGTAAAATGTAGTGAAGAT
AACAAAGTTGACAAAGATCCTGTTTCGTGTGTGTAGTCCAAGTGAATGAACGATGAGAAGGGGTGACCTACGAGATCGTGGGTGGCAACGTGTTTAAGTA
GACCACCGAAGTCGCCAACCTCGTTGAAACCAAGAGTAAGCTTATAAAGCGGTGAATGTGCATGTGGTCGGTTGGAAGAACACTAATCATTGATGATTGA
TGCGTGCTTGTAGCTTTGGCCAACACTGGAGTCGCAAGCAAGAACGTCGTCGGATACTTCCAGCCGGAATACAGCGACAATACAAGACCCGGTACAGGTT
CAATCCGTACATGAGGTATGAGTACCGGAATAAATTGTAACCGATGAAGGTGGGCTCGACGTCTAGCATAAAAGCTGCACGCCGACACGTGATACGATTC
TGTCATGTCCCAAGAACATTTTGAGCGAGCTGACCCAGCCGCACAAGGGTGAAATGGATTATTATACTATACTGTATATACGCCGCATCATGAGAGTCCG
GATGAGCTAACGAGTCTCGCCAATCTTGTTCATATGTGCTTGTTCTAGTCCCCATTCCTTAGTATGCGATCCTGCAGCCGGTATACAATGGCGTGAAGAC
CAACATCTACATGTACTGCGGGGTGGTTATTGATCCAATGATGTTTGTAGTATGCGCAAGTGCTGGATCTACAATGCTCCCGGTGGCTTGAAGTTGTCGG
TATCGTTGGATGTGTTTGTTAAGATGAACATCTTTGTGCAGCTTGCGCATGGCCTTGAGGACATTTTGTGCTCCGTGGGATTTGATGTAGTGCTTGCCAA
GAAACGAAAGTAACCACATCTAGCGACATCGCCAAACTCCAACACATCGTCTCGATACTGCGGATACTTCTCGTCAAGCACGAATCCATTAGCGAGAAAC
AGCTTCATAAATACAGCGACAAGTTTGGAGGTAGATTTCTTGTGCTTGCTGGAGCAATCGAACGAATCCTAGAGGCGGGGTTCCTGGGTATATCAGGAGA
ACCATACGTCCTTTAGGTTTGTCGATGAACTCGTTCGGCGACGTTTGGCTGGTGGTTCTTTGCTTTTATCCTCACTTCTCTCTTGTCTAGTTTTTGGCTG
TGCTTTGTTGTAGACCTCAGCTTCCATCATCGAGACGCGAGAGTCGAACCTTTGGGTGACCTTTATTAACTGTTTAATCAATGAAGCTTGATGAAAAAAT
GTTGGGTGCTTTTGATGTCGATGGTGCTGTCTTGAGCCTTGATGAGATTTGGTTGCATACTTGTCTTTGTGTAGCAGTTTCGATGCGATGACCAATCTAG
AAGATCGCTGACGGAGTGAACTTGCTGGATGAAGCACGCTTCCAAACGTGTGACTACAAGTCAGTATTTCTTGAGCTGCTTCAATGATGGATAATGAATC
AGCAGGTAAATGATAAGCGTTTCAGTAACCCTTTTGTTCACGTTGTACTATGTAGTCGTGAGCCCGTGAGACGCATTGAAGAGCGCTGTCGCAACAGCTT
TGATCTTTGTCTGCGTACCGAAATCGAAGACGTCAAGTGATAGAAAAGATGCGTCGGTATCGAGGTGTCGCCCACTCAAGACCCGAGCAACCTTGTGGTC
TTTGGACGCTGTATTAAAAACGTATGCGAAGGCCTTATTCGTCGCTGTCATATTCCACGCCCCTCGGTCGAAGATACACTGTACACACAAGCCAGCCCCA
TTTACATGCTGCTCTTCTCTGCGCCGAAAAGGGTGAGATGTCAAGCGCTCGGATACGCCATCTTTTGCCGCGACCCGATCAAGAACACGGTTAATGTAGC
TGTGCACACCAGCAGCGGTGTCTGGGCTGTTCTTGTTCTTAGCAGTGGTGGACGATGTATCCGGTGAAGACACCACAACCTCTGGGTGACCGAGCACATC
GATGAGCGGAGTTGCTGGAGCTGACGAGGACTGTGAAATACACGTCTGCTCAGGAAGTTGACTCAGCACAGATATAGCTGGCGATGAGTGGGTCACGAGG
GCGAGCGCTATCGCAAGCAGAGGACATGTGGTGAAGTCTTCGTCCGGATAGAGCGATAGACCTTGCTCTTCAGAAGTCTTGATGCGGATGAAACGGACGA
AGAATATGTCGCCCAATCCGATAGACAGGTTAGCCTTCCGCAGCATTGTGAGGTCTGATGTGCACCTGAAGAGGAACTAAAGCAGACACAACAGTGCCGC
ATCTTGGTAGTCAGCACTAGTAACCGCAGTTGA