Description :
From Genome Similarity Track
Location :
scaffold_14:415955- 417152
Sequence
1197 bases(100 bases per row)
ATCTATCAGAAGATACTATGACTGCGTAAAGTTGAGCGCAAAGATTAGGAGAATAACTAAATAGACTCATTCATTCATGAAAGTAGCTGGTGTAGACAGC
CGCCACACACATCACGCACATATATTGCCACGCCATGTTGGCCATTGGGTACATCAAGGTCGTTGCTTCCTCCGCATACAGATCACTGAGCTACTGGTTC
ATTGCGAGCGCCAATCGAGCTGGAGAAGTTGGTAGTCGAAGTGCGAAGATTGCATCTTGAGGCTTGCCTCGAAAGCTGACACCGAAGCCTTCCCATTCTC
TGATCAGGTGGTCCCACAATCTCTTGGCATGGGGGCATGTCCAGGAGACGTGAATCAGGTGAGATCTGTCCGATCCTGAACATGTCTCATGTGGACACGA
CAGGTTATTTGCTGTTCGGTTCCACGAGTCACCTAGAGTCCGGCCTTGAGTCTCAACATGATCTCCTGGGCTGACGAGGTTATCCCATGAACAGCGAGAA
TTGTTGTCCACTTCAGGTTGTCTAGGTCGGCTTCAAGCTTGGTCGCCTCGTTCGTAGATCCTGCTGAGCTGTCCATTCGTCCATCTCTCTTCTTGATGCC
GTCCTTCAGTCGCTGTTGTTGGCAATGGTGCTTGAGTGTCTTGCGCTTTAATTTCTAACCCGTTCGTCCGCATCTCAAACTGACTATTCGAGACAGTCGC
GGGTGTGGATGGAAGGAGACAAGGATGCCATCAAGATCTCGCTTCGCTACTTCGTCGGCGTCCTGTGGTCTCTCGAAGAAGTGAATGCTGATTGTGATGG
CCGTATCCTGATGGCGTATCGTGCTGTCGTTGTCCAGGNNNNNNNNNNCTTCTTTATGCCATCCTTCAGTCGCTGTTGTTGGCAATGGTGCTTCAGTGTC
TTGCGTTTGAATTTCTAATCCGTTCGTCCGCATCTCAAGCTGACTATTCGAGACAGTCGCGGGTGTAGATGGAAGGAGACAGGGATGCCATCGAGATCTC
GTGGCGCTACTTCGTCGGCGTCCTGTGGTCTCTCGAAGAGGTGAATGCTGGTTGTGATGGCCGTATCCTGATGTCGAGGAACCAGTCATGGTGTTATTCC
ACCTCTGGATCCGTCGGTCGAAGCGCAACAGCAGCCGTCGGGCGATGGAGCAGCTCTGGAAGTTCATTAAGAGAATCGAGCAGAGATGATCAAAGGA