Description :
From Genome Similarity Track
Location :
Scaffold_255:41594- 42931
Sequence
1337 bases(100 bases per row)
CATCAGTGATCCATACTGCACATCTCCGCCTGGTGTGCTCGATCCCACTTTGGAGAGCATAGACATGATTCCATACGATAGCTTTTCTTGGCAAACTTCC
GTCACAGGTGTCTGCACATACAATACGTTCGTGTGCATGCATACATCAAAAGCGACTGCTCCATCACTGCGTGCGAACAAGTGCACGACTTGATTCATTG
TATGCCTAGCCAAAACCTTTCTGTTAGAGCTTTCCATACGAAATAGTGTTGCGCGCAAGCTGCGGCGCTAGATATAAAGCTGTCAGAGTAATGCTCTTTT
CTTTGCCGTTCGCGATGACGATCAAACTCACGCTTCCACATTTCGTCATCTTGAGTGACTTCCCGTCTACAATGAAAACTTCGTGGTCACAACTTTCCAC
GTCTTGCATCATTGAGGCGTCGTTCACCAAGTGACGACTCGATACACTTTCCAGAATCCAGTCGCTCAAATCACTGTTGCATCCGTCGCCAATCACATTC
ACAGATTCAGCTGGTGACTTTCGCCCTTTCCCGCCACGCGTCCCTCTCCTGCACGATTTGATTTCGCTGATCGCGAGAACCATATCGTCGTTGCTGACCT
TCGGATAATCATCGCCTTTCCCCCTTCTGACAGCGCCCTTTACCTTCCCACGACAATTTGCTTGGATGTGACCTGTCTTTCCACACCCAAAGCATTTGCG
AGTATCTTGCCGATGGGGCAAAGCCTCAACATGCGTGGCGACGATTTCACGCCCAATTGACCTGCTCCCAAGCTCAATAGACGTTGCAAAGTGATTCAGC
TCTACGGCATGTCGTAAGTAATCGGCACGTGTCGGGTCGTACTTTGATCTCATGACATTCATGAGGTCAGGCGATGCATGGTGCACAATGTTGTCTAGGA
CTAGCGAGTCTGCACCGCCTCTTGCATCACTGAACGCTACCAGGTACAGAAAATGCTTGGCCTACAATCAATTTGCGTCCTTCTTTTGCGCAAAGAGTTT
CATCGACTGTCCAGCCGTAATCTTCGTCTTGAACGTCTCCATAGACGTCCCATCACGTAGTCGAGTGTTGCATGCTGGTTCCACCAAAAGTCAACTTGCT
TATGGTAGTACCTTTCAGCCGTACTAGCTAGGTAATGACCGAGCAAATCCACCTTAACATCTTCTCTCCAGCGAGAACCACAGGATACGTCGGCCAAGTT
GACCTGTCTCAGGACGTCTTTCCCCAGTCGTAAAAACCAGATCCCGAACCGTGATACAGTTCGGTGCCATCGAACTCGCGAATTGTAAGCTTCCGTTGAG
CTGTCGTAGGTGTCGCGAAGTACATGCCTTCTTGGTG