Description :
From Genome Similarity Track
Location :
scaffold_6:415903- 418633
Sequence
2730 bases(100 bases per row)
CCCTACACGATTACTTTCACCAAATTTTAGACGAACATCTTGAGCTTTGAGAATTTATGTGGATAATCGTNNNNNNNNNNAAAGCtgagccagcaactgg
ttttgagcaggGATTACAGCGATCTTCGGTTCCAATGACGCCAGGCGCtctaccgtcgcacgaaTTGATGTTTTTGTCTGcccgacggctaggagccgct
ccgatgGAGCGCGATagccctcaacgtgaggcagccaGTGCATAAattgctccaggctctcgagggtttccgcacagcggtgtgCAGCCCCGACACGATC
CACAGCGGAGTCTCGATCGCGATGGATTTTGTCTtccagagctcgaagagcatcgcgagccACCGGATGCCGATCgactaagtcgtcatcgtccgccgcc
gactcttctcgatgagattggTGGCGTTCactatcacgtagaacgtcttgtgggtcgacgtcgtcgacagggtcaaacccaacatcttgtgaagtggcgg
tgaTACctaaactccgagaactcgtggaagtttgaggtgccacttcggcgagactgcccagacgtcatgaacgcttatgatcagagggatcatttcatga
cgctccgcgtcgtcgtacgccccacgcttcccggcaGTAGTCccagaagccgaagggccataagctgagctcaagctatggacCTGAGCCACTGTAGTCG
TAGACTACCCCTGTGAGAGACCATAAAGGTCGTGGGAGCGTTATGGATAATTCTATATGACTCAGGGCGGcgatacgcaggaagtcggcgttgcgccttg
aattACTCAGTATTAAGAcggcgttctacgcgcatgCTCACTGGGGCTCCGAAGTGAGACagttccggtgccgctgcaccaattgctcaaagaACTTCTC
ACCATCTGCAGCGATttcaccaggggcgagcatcactggaatcgtccgcattgcgggcacaggagcgcctccttttgagctcaaagtcgagcgcgttacc
tatccattgaaatttcttgtggttccaagaagcgagctcgcagagctttccgcttgccaagctcagcttgtgtagtagcCAAGGCGCGTCTACGTaggcc
taacgatcgagtgattgcgtctttcgcttcagtagcaagATCCGCTGagcagaagccgtattccacacgagggtcctGGACCGaatgtggatacgagcgc
atgagggTCAGCCTCCAActactgctcctgtgcctcatagaggcgattggtaatcaTATCACTTCCTccgaaagtcgagaggtcggagaACGgccatggt
gtccgcaaggtttgagctgggcttacatcgcgccgttggcgcacttcatcctcctcgtctttcCAGGATATctaactcgtagtcgacttcctccgaatcc
tcgacgagaaattCACACACACACGCCCGGTTGCTGTTGCTtaagatgtgcttcccgtaaaGCCGCGGATGTACTATctggagatgcaccctgcagcggg
gctgccacagctttgcgcttaaaggaagcgtaagttaggtcaccgacctttcgttctttacttagaacaagtacgagtgtagcggatcgcaatccgctta
ctccaagagtaattacaaccttaaccaaaggctaattaactcttcggttaaaatttaaaactgactttatttatttctatctgcggcaaagccgcctaat
tttaaaagcatagattttcccaaatatatatagtaaaatctatatacatgtataactactggctatccagccctgtacagtattcttgtttgggtgtagt
cacaccatgcccttCCGGTGTGATACAtatccctgttaccagggtatgtgtaaccccgttacactctctccCATTAGGATTgtaaacatttacagttcca
atcaatttTTCCCTtaaacgaggcttgcgtttccgttagacactgcgttggaacaaaacgacttccgtgctcaatgagccctgtgccaatgacaccgaag
ccTCCAAGtcttgctggttccgacagcgctcacgggcagagcccagcttcatctcccgcattcggtgccatgtcggaccgtgtcttcgcggcaccgaggg
atgtaaaatctaggcttgatgagcccgagaatcgcgctccgcgcaagCTAacgtcgactacgagtctgacactccttttcccggatggattgacgaggaa
ggcgagccgtgctcgcgccttgcggaccctttgtccgtttcctgacttctcgtcacctgaggaacgtggtgtgatcgccaatgacctcgataaGGCACCG
atgcggcagctggaagctgcccgtaaggcggctctgatgcgcgcccatcacCGGTAGGTCATTGACCTTCGTGTGGGATATGGCttcccggcggatcccg
ttgtggaagcgaaggacgtggtaactcggTCGTtgcgcctccacatcatcggccccccggccattacagaagatgagcttgccggacggaaagctcttcg
agctcatttCTTAgtttccacaagaatttccgttggaagcttatcgcactcgtctgagtgctcaacgaggtggctctcgtgtattcacaatgcggacgat
acctgtaatGCTCGCCCCTGACGAAAGTgcaacagatgacgaagcgctctttgagcgatgggtgcaacggcaccgcaaactttctTCACTGTATGCCATA
CAGTTGAGcacaaggaagtagacgtgcgtg