Description :
From Genome Similarity Track
Location :
Scaffold_4:41562- 42718
Transcript NameFunction/comments
Phypl_g162hypothetical protein
Phypl_g1632-oxoisovalerate dehydrogenase subunit beta, mitochondrial precursor

Sequence
1156 bases(100 bases per row)
AGACCTGGCCGCATCGATCTCTGGTACGCAGTTCAGTCAAGCGTATTGTATAATTGGGATTTCAGGAGCTAACCATGTTGCATGCGTTACCAAATTTAGG
GGGTCAGAGCTTCTACGATCGCTTGCAGGAAGAGGTAGCCAAAGAAGTCCGGAACAGCAACTACGAGGATTACTTGGATGAGTTTACCCAGACCCAGTTA
TTCTGCCAGTACTACGAAAGCCTCTTACAACCAGAGGCACAAAAAGTGCTAAAGTAATTCAATACAACTCGAGCTTTGAATAAAAATGTTGAAAACGTGG
TGAGATCTGAAGATCGTTAATCATTAGGCGGATAGGCAACGCAACTAGCTCAATTTAGTAATCCACAACCTTCTTGATCGCCTCGAAGTTCCGCAGCGCG
TCCGGAAGGTAGTGCTGAGATCATCCATCGACACGAAAAAGTAAGATATTAGCACTTACCTATTCAAGGCGATAGAAAATAATGAAAAACTCACCGATTC
ATATGCTAGTGGGAAGGGGGTGTCGTAACCACAGACACGCTGAATGGGGGCctccaagctcaagaagcaccgCTCCTGCATACTAGACGAGATTTCGGCG
GCGAAACCACCCGATTTCTACAAACCCAACACCAACACCATCACGATTAGCACGACTACTCCGCTGAAACCAGCAACTCATCCTGCTATCACGTACCGGA
GCTTCGTGGCTGATAACTAGCCGACCAGTCTTGCGGACCGAGTGCTCAATCGTGTCAGCGTCCCAAGGGAAGATCGTCTGCAAATCAATGAGTTCACAGC
TGATGCCGACGTCCTCGGCATACCCGCAGGCTTCTTCAAGCACTCTCATCTGTGCACCCCAGCCAACCACCGTGACATCCGTGCCTCGCCGCACAATCTC
GGCCTCACTCAGGTTCTGCACATATTCCCCCACTGGCACCTGCAGTAGTACATCAACACACAACTACTCGTGAGCAATGCACCTCCTACCTTGTTTCACA
CCACCGGCAGATTAGCCGCTTCCTCACCTCTGCGACTGATGCGCGATACAGCGCCTTGGGTTCCAAGAAGATCACGGGATTCGGGTCCCGGATAGATGCC
AGCAGCAATCCCTTTGCTGCCACCGGGTTGCGTGGCACGACCACCTTGAGTCCGGG