Description :
From Genome Similarity Track
Location :
Scaffold_80:41559- 47733
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_80-snap-gene-0.28Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_80-snap-gene-0.29Conserved gene of unknown function

Sequence
6174 bases(100 bases per row)
GGATCGACGCACACTGAAGTTCAAGAACCACATTGTGGAAGAGGCGTTTTACAGGAACTGGTACCTGATCGACTCGTGTCCGTTCGACCATCCGAACGCA
GGAGAGCTGCATCGGAAGGTCTATCGCTCGATCCGGTTCGCAGTCGGGGGCGCCATTTTCTCGCAGCTGCTACTCGCTATCCAAGACTGGGAGTACCTGT
ACCGATATACTAGTCTTTCCGATGATGACGATGCAAGGGTGGCGTACACTGTCGCGACGTCTTTGCGCTTCGTGCTGGTGATCCCAGCGTACGCGCTAGC
TCCGCTGCTGATGTACTTCTTCGGAAAAAGATACTATCGCCGCTGGCTAGCACTCGCCACATCGGAGTGCCGAGGCGGGCTTCGATCTCCGACAGGATGG
AAGAACCAGACGTCTGCATGCTTAGAATACAGTTCAAACCGAATTCGCAGTACCGCTACTACGTACACGTCAACGTCAACTGTCTCGACGGATGGCTACT
GCTCGATGTCGACGCTGCACGCCTCTGGAAGAAATGGTCAAGTACTCGACGATGAAGAGGCTGAATCATCATCTTCTGCTTCTCCGCTCCCGCCATTTCG
AACGAACTATGTCCGTGACATGCAGTGGATGTCAGCGGGAGTTGTCTTCGCGCACTCGCTGGCGATGGGGCTCATCCTGCTGCTGGTCGACCAGTCTGCG
AGCAAGCACAACAGCTCGGCGGCGCCGTGCTACTTCATCGGGTTCCTGAACGCCATCCTGTTCCCGCATCGGTCAGGCTTCCGCGTCCGCTTCGTATACG
CGACCGCAGGCACAGTGGCAGTGTCGCTTATCATGCTCGTCATCTCGATTGGCGCGAAGGACCCGCACTTCCTGTCGTATGCGCCGTACGTAGCGCTGGC
GAACGTGCTGGGGATGATGATCAGCCACGAAGAGGAGTCGCTGCGGCGCGTTTTCTTCGTACGCATGACGCTCCGCTCGGACGAGTTCCGAAGGCGTCAC
GACGCGATGTGCAAGTTGGAGGGCTGGCTGCGAAAGCGCGTCCACCACTGGCGCGCAAAGCGTCAATTCAAGGCGCTGCCATTGTACGAGGTCGCTACAA
TGACAAACGCGGTGGTGAAGCCACTGCCATCGCTGTCAACAAAGATCCCGACGATTAACCAGATGAGCCAAGCGAGCAAGTATGGCATGGTCGCAGAGGT
CGTCAAGGCAGTTTTTGCATTCATGACCGAAGTCTTTTAAACAGAATGGGTATACGTGGCGTTTCTCATTCTCAACAAGGCTGCGTGGACCGCTGCTGAC
CTCAAATGCCCACCATGCGCTAGCTAGCTACTGTAGTCTTTCGATCAATTTCCAATTCATAGTTCCAGAGCCAGCTGCTCCAAGAGTGCTGGCGTCATGA
TGCTTCCGAGTGACCTCAGTGCGTTCATGTCCACGCACTCAGAGTACTTCTCGCAAAGCCGCTGGGCGATCTCAATGTGCTCCATGCACACAGCGGAAAC
CAGCGCCTTGGCATTGCAGCCTTCGCTTCGGTTCACATGCAGGAACAGCAGGACCTCAAACTGTCCTTTACTTGCAGCGAACGCCATTGCATCAACAGTA
CACCCTTCACTGCGGTTCTCGTGCAGCCATGCGACCATCTCAAGATGCCCACTCGCAGCGGCGAGATCCATTGCTTCTGTGGTACAGCCTTCATGACGGT
ACCCATGCAGCCTTCATGACGATTCCCAAGTGTCCATTCTGCGCAGCGAAATCCATCGCGTTCTGCGTGTAGCCCTCGCTTCGGTTGGTATGGAGCCACT
GGATCATTTCAAGATGTCCGTTCTTGGTTGCTCCATCGCTGTCTGGGTACAACATGACGGCGTGCTGGTACTAGCGTCGTGAGTTGCAGCATGAAGCCAC
ACGACAATCTCCAAGTAGTCATTTTGAGCGGCACAATCTATCCCATGGTGGGCAACAGCTCCATGATTTGCATACAGCCACTGGACAATCGCAAAGTGAC
TATTCGCTGCAGCCTCGTTCATAGCCCTCGACGAGCACGCGGTTTCTCTGTGATACGCATGCAACCACTGGAGCACCTCAAGATGGCCGTTTTGCGCTGC
GTTGTCCATTGCGCTGGTCGTGCACCCCACGGCGCCATACTTCTCGTGAAGCCGCTGGACAATGTCGAACCGTCCATTAGCGGCAGCGTAGCCCATCGCC
CTGCTCAAGCATCCTTCAGTTCAATTCTTGTGGAACCATTGGAGCACGGCAAGATGTCCTCCTTGAGCCGCCATATCCATCATTGCGAACGAGCACTCGA
TGTTCTTGCGGTGGTGGAGCCACTGAACAATCTTCAGATGCCCGTTCCTCGCAGCGAGCACCATGGCGTCGAGCCACTGGACGATCTCCAAGTGACCCGC
TTCCGCAGCGATGTCCACCTCCGACGTTCCGATGGCGCGGTTACTCGATGGCGGTGGCAACATGGGGAAGAGCCACTGGATGGTCGCTAAGTGCCCTTTC
CAGGAAGTGAGTCCCAGACACGCCACCACATCCAGTCTGTACCCGTTCTCATACAGGAACTGCGCGATCTCCAAATGACCATTGAGAACAGCAGCAAAGA
TCGCTCAGCCGGGCTGGCGTCTACTCATTATCTCCATTGAGAAGCGCTTGTGAAGGTACTTGACCGCGTCCAGGTGGCCACCCTGGGCTGCACTCGCGAG
CGCGTGGAGAGCGGCGTCATCCTGGTGCAAGTACTCGGACAGCCATTGCAGCACCTGTATGTCGCCAGTGGATGCAATCGGGCCGACTGCAGCGGAGATT
TTGCAGGCGCCAGCTATACGGCAGTGATACCTCACGAGCCTCATCAATATCAACACGTTCCCATTCATCGCCGCCTTGGCCATCGCTTGCTGCAGATGCA
CATTCGGAGAGTATGAGTGCAACACCCACTCGATCATCTCCAGGTCATCGTTCTCCACTGCAGCCACGAGCGCCTTCCTGCAGTTGAAGCTGTGGTAATG
GCGGTTCGAGTCTGCAGGCTCGTGGGATGCCAAGCGTGGCAGCAGCGACATGAAGCTGCGCTTGCTCGCGCGCGGGAGGCTCCAGAATTTGGTGACGCTG
CAGTCGAGAAAGCTGCTGATCGTGAACGAGACATCCAGCAACAGCGCCGCCTGTGCGCGCGTGCTTGGCTGCTGGACTGGTAGTGAGAGGCTCGCAGTGC
AGCATGACCTGCACACATGCGAGCGGTGCCAAGTGCATCGTCATCGCTGCCGACAATTTCGAAATGGGTTGATTGATTGATTGAGTTGCAACGTGCGATA
ACCAAAGGGTAACTTTGTAACAAATGATTTGCAGTACGGTTTGCGGCTCACGCTAGCAACAGATGATATAAGGTACTGTAATGTTTGTACTGTATATCCT
TTGTTGCTAATGCGTTGGGCGGGTGATTTGTGTTGCTCTCAAACACAACGCAAAGGTGTTCATAATCGAGCAATCGATCAATGGCGACCAAGGAGAAGCT
GCGCCGCGCGAGCGCTCGCGCGATTAACAAGGCCGGTGCCAGCATCGACAGCAGCAGCAGCACAAGCGCAAGCGCGGGAGCCAAGTCAGGTGCCAAAGGC
GCATCACGCTCCAGTCCCGCCGTCGCCACGAAAAGCAGTCCCGCATCCGCCAAGAAACCCCCAAGCGGCAAGAAGACAAAGAAGAAGCCCGTCAAGTGCG
TTTGTTTGCTATTTGGTTGCGTTCTTCTTGACATGCGCAAAATACTGTGTGTCGACTCGGTATTGGCCTGTGAACTTACTAATTCTATGTGTATGTGTGG
CAATAATGAATCAACAGACGTGACGAGAGAAGCGCTGAGGAAGACGACGAGGATGCCGATGAGCTGCTCGCGAAAGTGAATGAGGACACACGCAAGATCA
ACCCGTACGTCCACTGTCTTGAATTGTCTCCCTCTACGTATATACATATATATATATATATATATATCGTGTTGGTGTTGCACCAATGATGCGTTTTTGC
CGTACGTGTGCCGTGTGGATTGTGTACAGAAAGCGAAAGCGCGGCACGGTGAGCGCGGCGATCCTGGATGAGTTTATGAGTCTCGACGCGCTTTTGGACA
ACGACCTGGAGGTAAAGCGCAAGAAGCAGGCCCGCGAGCGCAAGTTGCAGAAGCTGCGCGAGGAGTGTGATGCGTCGCTCGCAGACTCGGGGCTAGACGG
CACATCGCCGCTTGTGAAGCTCATGAATGACATGGAGAGCAACATGACGAGTCTCTCAGCCGACAACTACCTGTTCTTGGACAGCCTGCAGACGAACCAG
GAGCGATTCGGCTACGTGTTTGCGCCGATCACCGAGCCGCTGCCATACAAACCGTACGAGGCGACCCCGTCAGAACTGAGCAGCGACCTGAATCTGGTGT
ACAAGACGATGGAGTCTGCGGACGACAACGAGATCGCTGCATTGCTGTGGACGAAAGCGATCCTGCTGCGCTGCATCTTGGCCAAGGCTGGCGGGGACAA
AGAAGACGAGAAGGCGCCGATCCTACTCCCTGAGAAGATCTGCTCGTGGCTCTTCAACACAAGTGAGTGCCGTCCGTACTCCTGGACGTTGTTTGTATGG
AGGTGGTGAATGGTCGTGCTCATGTCTGTGTTGGTTTGTTTGTTTCTTGGTCACTTGATTGCAGTGTCCACGCACAGCAGCAGCCACGTGGTTCGTGGCT
GTCTGAGTAATTTATTCATGGTGCTCGGCCCCGAGCACATAACCACAGCCGTACGTCCGCTCCTGTGTTACTTGTCATGTACCACAGTGATCTACTGCTT
TTACCAACTAACCTGTTGTGGTGTTCGTAGGAATTCCAAGCGGGATTGCCGAGCGCAGCCTTCTGTCAGCCGAATGAGAGCTATCGTGCGATCCTCGGAG
CAAAGATGATGAGACTGAAGATGGAGTGGCAACCAACTGTCTACGATTTCCTCAACGCGTTCCGCACTTTTGGGTTTCAGGACAGCAAGCGCTCGATGAG
CGCGAAGAGCAAGATCGAAGTGAGTCCACGGAGCAAGGCGCGCGAAACCGCGGCGTTGCCGTTCCCATCACTCAATATGCAATACGTGCTCATGTATTTA
GTGATCTGCCTCCGCGCCAAGTGAGTGAACTGTGATGGATCTTGCTTTGTGTGTGACGGAGAAGGAAGAGTTTAACGTTTCCTTTCTTGTCCATAGAATC
CTCAAGCTGGACGGGTACGATGCGTTCAGCTTCACGATGTTCTTCTTGCGTATGCAGTTTGAGAAAAACATGCACCCGGAGATCGTGCAGCTTGCATCGA
TCTGCATTGAAGAGCTCTTGGAGGTGTTCCCGACGCTCGAGTGGCGAAAAGAGTGGGCGCCATCGCTCGTTCTCCGCATCGCTGGAGTCAACGAAGGGCT
CTTTGACTCGGCGTCCGGGTGGTTGACGGTCGCGCGCCGACTTCCTCGAACGATCCGAGGCACGCAGCTCACCACCGGACTGTCGATCTACGTGCTGCAG
CACCGCATTGACAAAGCCCCTCAAGAAGGCGTGAGTATCTCTCTGTGTTTGTCGACAGCGAGTCTCATTAGTCTTGATACTCGCAGTCTACTGACGAGGT
GTGTATTCATTTCCTCCTAGTCCAACTCGGAGCGTCCGCTAAAGTTCCCGATCCAGAGCGGTCTCGTGCTGGACATTGTCGCGGGGATCGTCGAAGACCT
GACGCTCAAGTACGCGGAGAAGCGACAGAGCGGGAAGACATCCAAGACGGCGCCGCCTTACGACTTGTTGTGTAAGAAAGTGGCACTCATGGACCTGGCG
CTGCAGGCTTTTCTCAACATCCTCACACAGAAAGAGATGTCACTGCTGCTCAAGAAGCTCGATGCACTCACGGGCACGCACAAGTCAACCATGTCGGCGA
AGTGGCACGAGGTAAACCATTATGCATACTCTGGGAACAATATGAGGGTGTCTGTGAACCGTTTGGCTAACAGTGCTACTATGTGGTTGATGGCGTTCGT
GGCTACAGCTGAAGACGCTCGTAAGTCTCATGCATCGCAAATACTCGCTCGAGAACCTCCGGATCGGCCGCGAGGAGCCGCCGCTTGCGAAAACGGCGCT
CTTTGTTGACGACAATGCAAATTAGTGGTGAGCTCCAGTTTTCTTGTCAGATGTGGTGGCATTTGACCAACTTC