Description :
From Genome Similarity Track
Location :
Scaffold_188:41548- 46683
Transcript NameFunction/comments
Hyaar_Emoy2812186hypothetical protein
Hyaar_Emoy2812187hypothetical protein

Sequence
5135 bases(100 bases per row)
AGCACAACCAAGTGACCCAACAAAACGAGAACTTGACCCCGAGCTCCATGCTGACGTCATCCGACGGTCGTGGTCTCGTGTTCGACACGTATGCGCTTAA
GTGATTCCTTCCGTCGACATTGCCGCGTATGTTAATCTAGAGAGGTGGCAAGATGGTTTGGCGTGGCCCAAGGTTGTTGACTATTTGCAAGCCTCCCTGA
CCACCACTTGGTCATCCCGAAATGCGGTTTAATTTGCCACTTTGGCATAGCTGCTAAAGAGTCACCTTTCTGTTGAAAAGCTATTGAGCAACATGGAGAT
CTCAAAGCCTGCCGCCTGCCCTTCACACTTGACCTCACGCTTGATACAAGTAGCCAAAGTAGTTGCAACCATTGCAGTATAGCACATTCACTTGCCATGA
GGTGGGCAAGTGAAATGTGCTATACTGCAATTTCTCGATGCTTCATGAGCGAATAGTTTGCCTAAAACGGAAATTGCTGGAGCTGTAGGACTTGCTGCGA
TGCCATCCAGCAAGATGCTGACATCGCAGCAAGTCCTACGGCTCCAGCAATTTCTGTTTTAGGCAAACTATTCGCTCATGACTTTTCATCGAGGCTGCAA
TGCAAGTGTCTGTCGTTTCCGATCAAGAGAATATGCGAGGACCTGTCCACTGATCGTGCTCGCTAAGAGAGTGCCCTTGTCTACCGTGCACAAGCTTGTG
ATCATGCACTTTGGGGCTCCTTCTGCATATGCTTCCGCCAATGGAGATAAAGACGATGCGTCCCTTACCTTCACAATACCATCCGTGGAGGCCGTCACAG
GCAGCGGTAGCCGTCCACTTGACTCTCTGTCGTCTTCATTTGAACTCTGATCTACTGTGTTGGGCAAGAAACAGCAACCTATTGCATCGTGATCACCGCC
TTCAAACTTGACCACCTGCTTACCAGTGCGTCGATCCCACACCTGTGCCTCATAGCCGACGCCATTCAAGCCCTTCCTAGACGTCAACAAGTACGTGCTG
TTGCTATCGTGCTCACTGTTAGACGCTGCAATACTCTGCGGGAAATGCCGAAACCCTCGCAGCGTCTGCACCGGCGTTTCTAGCGGCGTTCTTAGATCCC
AGAGCTTCACACTCGAATCTTCACTGCCTTACGCACCGAGCGCTTCACCTGGCGACCACGTCGAGCACGTGACGACTTTCTCGGGCGTCGTGGTCTTGGC
TGCAATATAACTCGTCGTGAGGTCCCAGAAGATCGTCTGTGTGTCTCGTCCTCCTGAGCACAGCATTTGCTCGGCGTCATCAACTGCCACAGAAGCGAAA
CAGAGTCGATGACCTCGTAGTACTGTCGCCGTCTCTGAAGCCGGTTTATCCGTGATTGGCGTAATGGCTACCGTCGTGTCAAGTGAACACGAGTAGATCA
TCTGCAGCTTGGCTCCAATAACCACTTGAGTCACAGCCTCCGAGTGAGGGATCCACACGTTCAAGCCGTTGTCTGGGGCTCGTGCTTTTAGCCGCCAATT
GAGACGCTGGATCAAGCCATCGGTACAGCCGGTAAGGCAGGTATCACCCAAGAACGAGCTGTACTTGATGCAGTTCAGAGCCAGAAGATTACGCGCTTGG
TCGGCTATACCTACTACACCTGAAGCTGCTGCACCACTCGGAGTGAAAGCGGTTCCATCAATGAGACGTGGCGTCTCGTCCTCGACGGTCCAGTTCCAAA
GACGTCGCGATGACCCATTCTCGTCACGAGAAGTATTGGACCCCATGTGTACTATCTGTCTCAATGCTTTTTGGATGGAGCTGCAGATAAAAGCAGCTCT
CGGGCACCACAACACGAGTGTGGTGACGCTCGATTTGTTGACTCCAATTTGTAAAGAGGCAGCACATGATGCAGCGACATTGTTTGTCCTCCTTCTCTCG
CACGTCATAGCTGTGGGTGCCAGGTGCTGGAACTGGGCATTGTCGTTTGATTGATTGACAAACGCATCTCGAATTAAGTATCAACGCTGCACCGACATCC
TTGATGCCTAACACTCTCAAGTTCGTAGATGTAAGAGAGCTATTAGATGGAATTGAACCGATATCGACCGTGAAACGTGTCAACACATCACCAACTACTA
AGAGGACATGCTGCTAGTGGTGAGCATAGGATTTTGATATTTGTATGTGAAATACTGAAGCTGGATCGATCCTGAGGTTAACCTTACATGAGCTACAGTT
TCTTTTGGACACGGATTGCTTGCAATACAGACGTTTATGATGCAGACATTATTTGAAAACAGCCGTTATTGTGAGAAGTAGAGACGCTTCTGGCTAAGAC
GAAGACACAAACCATATGACAGAAAAAGATAGAGGAGCAAGCTCTGGAGCTCACACTTTGATATAAGTAATCCAGTTCGGAGAACTGAATCAAGCTGCAA
AACACTACACAACAGCAGCAGTCACTGAAGAATGTGTATGATGCTCATAATGTCTATATTAATCCAGTACTACATACTATACTCAAGCAACGCGATCAGC
CTTTGCTAATGGGCGTTGAGCATTTGCTTATGTGATCGTATTCACCTTTAATCAATTTTAAGCCAATTACGTGCGTGTGTCACAATAGTGACCTGGCCAA
AGAGTGACACCTATCATGTTAATCGACCTATGAGGGGGGACAGGCTAGATCGTACTTAGTACGTGAAAGGTACACCTAGCCGCGCTATTTACAGGCACAC
AGACACAGATAAGTACGATTAAAAAGTTCGGCATTCGACCTTGCGCAAGTCACTAATAGCTTCAGTTTTCGGGCTCGCAAAGAATTTTTCGAGGGACAAA
AATTCATACGAGAATACTCCTGAGCACAGGGAATCATATTCCTGTATAAAATGCACAATTGGGCGGGACTAAGTGTCTGAGTGGTGGCAGCCATACGGAT
GGGTATTTGAAGTACCATCCGCATTGGCCGTGTAGGCAACAGAGATCCTGCCAAAATAAAATAGGGAAGTTAACTGTTATTAGACTGAAGAAATCCAAAC
TTAAAAACATTTTCTAGGAATTAAACCAACTCTGACCTTCTATTACTTAAGATCCTCAATCTCTTTCTACGCAACTGTCTTTTCTAATTCACGATATAAA
TAATCCTAAATCGTTTTTAGTAATGTACAACTTCAGCGTAAAATTATGATTTCTTGATTCTCACACATTAGTTTCGTCTATGTTGAAAACATCTTTAGGC
TCTTAGCGAGAAACTACCACCTGAAATCCAGGCAATGCTGCATCCATACCTTCCTCATTTGCTAAACCACTCTCATCACTTTTCATTTTGTGACGCTTTT
AGCTTCACCCTGTCCGCTTCGTACGGGTTGCCGGGTTGAAAAGTAGCAACGTACATGCCCACCCATCCCTTTCCTGTCTTTAGGGACGACGCCAAGGAGG
TTTCATTCTTCCCGTCAGCATCATGCGCAGTATGGCAGACCCCGTCCCGGGCGAACCGCCGGCGCATGGGGGTGAACCGCCGTACCCAAGGGGCAGCGGT
CCTGCCACGACCACTTCCGAGGGGCATTCTCCACCCGGAGACCCTCCTCACCAGATCTCCGATACGGCAACCGCGACGCCATCTTCGGACGGCAGCACTG
GCGACCGGCAGCCGGGGCAAGCTCGGCAGGCGGATTGCCCTGTGACCCCCTCGAGTCCCGCCCCGTCGGCGGCGAAGCAGGCTACGGAACAGACGGTAAA
CGCGGCGCAGAGGCACCAAATGGCGAGCGAGGTGCGTCCACGGAAGATGTTTGCAGCTCTAGTCGCAGCCCGTAAGGCTGATCCGCTGGGCCCCCCACCG
GACGCCTGGACTACTACTCTCGCTGAACTGTTTGCTAGAGCCCATGAGGCGGTTTCTATTGACGAGGAGTTAGTACCGCCCGAAAAACGTCGTTTTCTCA
AACTATGGAGCGAAGAGAAAGATCTCTTATTCACGTTTTTATGATAAGGCATGCATATGTGGGGAGAGCTCTTTCACTGACTGGACTAGACAGATTACAG
CGGCGACTCGAGATTTGTATAACACGAGCTGTTCATTCACGCACATTGTACAGAACATGCTCAGCAAGTTGAAATGGGCTCGGTTAAAACCTTTGAATCT
ATGGACACCTCGCGGAGAGGGGGCGTCTACGGATACAGCCGCCATACCCGGTTCACCTGGGTCGCAGGTTGCCTACCTTGATTTTATGTTCAATCCGGCG
CTGTACAGCAAGCCTGACATTGCGACGTTGCGGTCGCTCTGCCAGCATCCGGTAGCTGCACGGTGCGGGCTTCGGCTACGAGAGGCGGTGGATGAGGGCG
TATCATTAGTGGTCTCGCGGAGGGAAGCATCGTCAGTAGGCGTTTACCCGACTTTGTAAAAAGCGTTCTCGACTCCAAGGAGCGACTCCGTCTTTACCGC
ACCATACAAGCCCAGATGGAAGGCGAATTGGTTTTGCAGTAGCGCAGTGGCACGACTATACGCGTTTGTCTCCAAAGTACGAGCGCCATCAAGGAGTACA
TGCCCTTGCAGCTGAACAGTCGAAGGTGAATCAAGACAAGCTGCGAAGCCTGCTCAACGTTGCGAAGACAATTTGTCACGACACTGTTCGGTGTCGGATT
CATATCGTTTTTCTTGACCGCCAGACAGCGAGTCGTTACGAAATGGCGACTATACCGTTTCGAGGGGCGCTTTACAGGGTGTCTAACATGCATCCGCCGG
TCAAAGGGTCTGTCTGGGCACGGCAGCTTGATACCGGAGGCATCCGACTGGCGGCTCAACGAGAGTATGTTGTGGAGCTCCACAATGTCACCCGCTTTAC
GGACGTCAGTCGACTAACAGCTTACTTTGAGGCCCACATTGCCGCGGGAGTTGAGCTCGATGATATGGACACATGCACGCCCAATTCCCTGACGTCTACT
GTGTGGAAACTAACCGTTAAACTCGCTGGATGTCCTGACTTTTTGTGTGGCGTTGTCCGGCTCATATGGTACGGCAGCACTATAATATTGAAACATCCTG
AGGTTGGGAATCGCCTTCAGTGTTTGCACTGTGGAGACGTCGGGCATCCCATGGCACGGTGTCGCTATGATGCAGATCAAATTCGAGGACCGGGCAGCCG
GGTGGCAACGGAGCAAGAAGTGGCTGGGCTCGAAG