Description :
From Genome Similarity Track
Location :
Scaffold_830:4154- 8609
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_830-abinit-gene-0.22AP-3 complex subunit delta
Pytiw_DAOMBR242034maker-piw_contig_830-fgenesh-gene-0.5Conserved gene of unknown function

Sequence
4455 bases(100 bases per row)
TTGACCCTTAAAGTCGCTACCAGATCCAGCACTCGCGGGCAGACAGCATACGGGCCAGCCCAAGAGCTTCATCACGCAGCTTTTCTCCCAAGAGTTACAA
AAAGTGAAGAGCCTAGGGAGGCAGCTCAGGCTCCACCGAACGAGTAGCTAGTCTTCTTTGGAAGCCAGGTCGGCACCCTCGCCTTTGCGTTTGAGATCCA
CGCGAGTAAGTGATGAACGAACGGATCTGAGCTGCTGGGCCTGAGAAGAAAAGATCTGCCAGATTTTGTTTGCTTTTCTGCGGTCTTGAATACCGATTAT
CCCCTCTTGAATCCGATCGACAGATCCTGTCCCACCCAACTCCGACCAAAGTGACAGCACGTGCAAGCAACGTGTCCCCCCTTCAAAAGTGATATTTCCA
TCAAAAAGCGAAAATCCGATAAAACTCACCCCTTCTTTTTGAGATCTGTTCCCTATTTTGACCAGGGGCGGAAGAAGCCACACAAAGTCACCAGAGAGAT
CCAAGGTGAGCGGCGGCTGCGGCGAAGCAAGCCCCCGCGCGCTCCTCTCTCACGCGCCACACACGTATCTGTGCACCTCCACACCACGCGCATTCGATTC
CCCTCACCCTGCTGCACCTGCCAGAGGCCTCATTGTCCGCAAGCGACCGCGAATTGACTGCGTGACGCCCGCTTCAAGTGCCATCCATCCATCATGTTTG
AAAAGAACCTGCAGGACCTCGTCAAGGGCATCCGGTCCACCAAGGGCGACGTGAACGTGTTCATCTCGCAGATGATGCAGGAGATCAAGAACGAGCTCAA
GAGCACGGACCAGTTCGTCAAGGCGCAGGCGATCCGCAAGCTCACGTACCTGCACATGCTCGGCTACGACATGTGCTGGGCGGCGTTCCACGTCGTCGAG
GTCATGAGCTACGAGCGCTTCTCGCACAAGCGCATCGGCTACACGGCGGCGTCGCAGAGCTTTACGCAGTCCACGGACGTCGTGCTGCTCTGCACGAACC
TGCTCAAGAAGGAATTTGGCAGCATGAACGAGTACGAGGTCGGCCTCGCGATCAACGTACTCGCGAACATCGTCACGACCGACCTCGCGCGCGACCTACT
GGGCGACGTCGTGGCCATGATGAACTCGCCCAAATCGTACGTGCGCAAGAAGTCGACGCTCGTGCTCTACAAGATGTTTCTGCGCTACCCGCAGGGCCTG
CGGCTGACGTTTGACAAGCTCAAGGAGCGCATGGAGGAGCCCGACGTCTCGGTCGTGTCTTGCGCCGTCAACGTCATCTGCGAGCTCGCGAACAAGAAGC
CGAAGAACTACTTGGGGCTCGCGCCGCAGTTCTTCCGACTGCTCACGACGTCGTCGAACAACTGGATGCTCATCAAGGTTGTCAAGCTGCTCGCGAGTCT
CGTGCCCGAGGAGCCGCGACTTGCGCGCAAGCTCCTGGACCCGCTCGCGACCGTGATCCAGAACACGCCCGCCAAGTCGCTGCTCTATGAGTGCATCAGC
ACGGTTACGACCGCGCTGCTGTACACGAAGAAGAGCGACGGCTCGCAGCCGCGCAACGTCGCGGCCATCGTGCGGCTCTGCAACGACCACCTGCGCAGGT
ACATTGAGGACCCGGACCAGAACTTGCGGTACTTGGGGCTCGTTGGACTCAGCAACCTCATGCAGTCGCACCCGTACGTGATCGCTGAGCACCAGGAGCT
CATCGTCGAGTGCCTCGCGGTCGACGACATCACGATCCGCATGCGCTCGCTCGAGCTGCTCGCGGGCATGGTAAACCCGGAGAACGCGGCGCAGATCATC
CGCGAGCTCATGCGCCAAACGCTCTCGGCCGACGGCGCGTACCGCCACGAGCTCATCGCGCGCATCCTGCACGTTTGCTCGGTCAACAAATACGAGAACA
TCCACGACTTTGACTGGTACATTCACGTGCTCGTGCAGCTCGCGCGTGTGCCCGGGATCTCGGGTGCCGCGGTCGAGGCCCAGCAGAACCTGTCGTCATC
CATCGGCCCCAATGTTTCTGCGAGTCCCAAGATCGGCTCTTACGAGATGACGCGCACGCGTAGCCACGGCATTGAGGTCGCGCGCCAGCTGCTCGACATT
GCGGTGCGCGTCAAGAGCGTGCGCAGCGTCATGGTCGAGAACATGATCGACCTGCTGATGGAGAAGGACGCGCTCAGCGGACCCGGCGCGTCGACGCTCA
GTGAAGTGTTCTACGCTGCGGCCTGGATCTCGGGCGAGTACGTCATGGAGTACCTCGAAGATGTGGACGAAGACGACGAAGACGAGGGCGAGGAGGAGGA
CGATGACCGTGTCACTGAAGAAGAGAAGCTCGCGCGCATCGAAGACCTCGTGGACGAGATGCTGCAGCCGCGCACGACGTCGCTCCCGGGCCACGTGCAG
ACTGTATACATCCAAACGCTGCTCAAGTTCCTCGCGGCGACGGCTGAGAAGGCCGACGATGACGCTGTCGAGAAGCTCGCTGAGATCATCGTCGAGCGGC
TGCCGGCATTTGTGCAGAGCGAGCACATTGAAGTCCAGGAGCGCGCCGTATCGCTGCAGCAGATCCTCTTTGCGCTCGGCATTGGCATGAGTGCGCTGAG
CACGCAGGAGCGTGCGTCACGAGCTTTCGACAGCAACGTGTCGCTGAACCCGTCGACGCGCCTGGACATTCTGAACTCGTACTTTGCTGAACGACTGGCT
CCCGTGGGCGCCAAGGCGCAGCGCAAAGTGCCGCTTCCGGCAGACCTGGATCTGGATGAGCCACTGAGCTCTATCGAGGCTTCGTTCCTAGAATCCGGGG
GCGATGTCTCGGGCTACGCGAACGAAGATGACCTCGAGGTCTCGTTCGTGCAACAGAGCTACAACAACAGCAGCAGCAACAGCGGCTACACGGTCTTTGA
CGACTACCCTCCGCAGCAGCAGCCGAATGCGTCCCAAAAGAAGAAACATAGCAGCCACCGCAAGGGCTCGTACGAGAACCACCGCTCGGGCAGCGAGTCG
TCGGCGTCCGAGTCCGAGGACAGCAAGGAGGAGCTCGAGCGCCAGTACGCGCTCGAGAAGGAGCGTCTGCGGAAAGACCCGTTCTACCTCTCGGGTAACG
GCAAGAACAGCGCGAACGGATCCACGGACCACAGTGTACGTTTTGTTTATGTTTTTTTACTTTGTTCGAAATTGTCGGGTGCTGACGAAATTGATGTGTG
ATATGATAATAGGGCTTTGCAGGCATCATGGACGCGCTGGACACGAAAAAGTCGAAGAAGAAGAAGGGCGAAAAGGTAGGCTATTTTTTTGTTTGGCTGA
ATGGAGGGTCTGCTGTTGAGATCATCGCTCACATACGTGTGGTCGATCTCATGATTAATTATTTGTTCTAGCAGCGATCGAAGAAATCGCGCGCGATCCT
GGAAGACGAGCTCATGCCGGACGGTGCGCGCTCGAGTGACGAAGACCGCCGTCGTGCCAAGAAGAAACAATTGTCCTTGTTCGACGAGGTACCTATACGA
TATTTGGAGCCAGTACTGGAAACTGGTGATCAGTGGTATCTAACATTGTGATATTAATCACCACGTAGGATTATGATCTGTCGGCTATCGACCTCAGCGT
GCCTTTGGGCGAGAATGAGAAGATCCCGGACCAGCACCTGTTCCACCGCCAGACAAAGGAGGATGAGGTCGTCGAGAAGAAGAGCAAGTCGAAAAAGACC
AAAAAGTCCTCGAAGGACGACCGCAAGTCGTCGAAATCATCCAAGTCCAAGCACCGTCACCACCATGAGGACGAGGACAATGAGGACCTGAAGGACGACC
GGAAGAAGAAGAAGACGCATTCTCGCTCGAAGGAGTCGAAGGAGAATATTTATGACAATGCGAGTTCCGAGGACGACGAGCAGGTAGAGGCGGACCAGCG
CCAGCATCACTCGAAGAAGAAAAGCAGTCATAAGAGCTCCTCGTCTTCCAAGCTGCGCGCCGAGGCCAGCAGCTCCAAGACGGAGAAGTCGACGTCGTCG
TCGCGGCCGAAGAAGGAGAAGTCGTCACGCAGCAGCAAGGACAGGAACACGAAGAAGCAGGAGCAGGACGACGAGCCGCTGCTGCTCTTTTAGACGGATA
CATACTTACATACATGTGCGTAGGTTGGGTGAAGCAAACGAGAGTACAAGCGAAAGTGATCAAGATACGAGCGAAGCAAGGGCGCGAAGGGACAAGACGT
TGAACAAAGAGAAATCGTTGCATACGACGGTCACTCGTATCTTCATGGCTCGTGCACTTGGTGAAGAAAATGCAACGGAATATTAATTGAAGACTGGCAT
GTGCACTCACAAGAGCTCACTCCTCTCTCTATCAAATGTGAACAGCTCCAAGTCATCACTTCTTGGTCTTGTGCTTCTTGGAAGCCTTGGTCTTCTCTCG
TTCGTCGCCGGCGTCGTGCTTGCTCTTCTTGCTCTTCTTGCTGCTCTCTACGGGC