Description :
From Genome Similarity Track
Location :
contig_166:4152- 7058
Transcript NameFunction/comments
g13995.t1hypothetical protein

Sequence
2906 bases(100 bases per row)
GAATGTATCCGAACGAATCGGGTCGGATTCTACGCTGAGTATGTTTGGAACTTCCGGAGGATCAAGCGAGTCGATGGCCAGTGCTACATCCAGTTCACGG
ACTTCCAGAGATAGTTCGTCCGGATCTTCCGGATGGAGTGTTTGCCAAGGTGCAGGAGTGCATATGCCGTTCTCAGCGTTTGAACCACGGGCAATGACAG
CTCAGAGTCTGGGAGGAGCCGTCCCGGCGGAGACTGGTGTAGGCATGTACGTCACTCACGAAGTGATTCCACGGAACCCAGTACCAGTGATTCAGGAAGA
CATCGTCATGTCAGAAGACGAAGCAAAGGGTTCTCGAAGACAGAAGCCCAAGGTTTCTTCCCGAAGGATCTCCCGATACCGGTCGTACAGCCGCTCGTTC
ATACCGCAGTAGTGCTTCCGGAAATGCTGCTGAGACGACACATCAGAAGCCGGATGTGAGAGGCTCTGATGAGATCGTCGCGGCACAATTGCAAGCTACT
TTGCAGGCATTTGCTGCTGACAGAGTTTCGAAGAACCTGATGGGAAAAACCGTGAAGATTTCTGAGCCTATTGTGAACGTGAAAGCGGAACCCGTTTCTG
AAAGTAGAACTTTTGCAATGGGAAAGGCCGAGTTGTCCTCTGGAACCAAGTCAACTGCACCTGGAAAGTCTGTCAAACGGCACATGTCCGAAAAATCTGG
TTCGTCCAAGAAAAGTTCGACTTCCGGAAAGGGGAAGAGGACGAAGTAGTCATCTGGAAAGTCAAGTGATCCTTCGGATTCGGATCCAAGTTCTGAGTGA
CTCGTACTCGGACAGTTCAAATAGCAGCTCTTTCGAGGATGTCGTTCCGAATGTCCATACGACATCGGGTCCAGGCGGATCTCTGTTTACGTTCAGGCCG
TACGTGAATGCCAGCACGTTGGAAGACTTCAATGAGAAGACGTCACTAGCTACCCGTATCCGGTGGTTGGAACGATTCCAGAGTTTTGCCGTTCAGGGTG
GTTGGTCGGATAAGGTCAAGATCTATGAGATGAAGCTGAAGTTACCTGCTGCCGTTCGAAACTGGCGTTCGAACTTGAATCCCAACGTGCGCCGGAAATG
GAAGAAGTTCCTGAAGGAGTTCCGTGATATGTATTGCAAGGCCAAGACCTCGGATTCAGAACGTTATTACACGATGATCCAAAAGAAGGCAGAAACTCCG
CTGGAATTTTACTACCGCCTGAACAAGGTGGCCGACAAAGCTGGGATCGAGTTCGACGCATCGAGTAAGCAACGTGAGCGCCATCTGAAAGTGTTCACGA
AGAAACGTCTGGACTCTCACCTCCGAACGACTTTACAAGGACAACGTCTGCGTCGTCTGAAGGATTTGGAATATGTCCTGAAGCAGCATGAAGAAATGAA
TCAAGACGACGATTACGATACTCCACCTCCGAAGAGAGACTTCCGAGCGGACAATGTCCCTCGTGATCGATTCAGACCGAAACGTTCTGGAAGAGCCTAC
GTCCTTCATGATGACGATAACCGGGATGGCGAGCACGACAGACAAGTCCATTTTTTGGAAGAAGTGGAAGAAGTGACAAGTCGAGATCATGCTCCTAGTG
TGCTGACTACTCCAGCTGCGGATGTCACGAACGTGTCCGGTTCGAGCATGGATAACCTTTCCGAAGCAGTATTTCGTGCGATGGAGAATCCCAGACGACG
GCCCCCGACTTCTGATTTCCGTTCGGATCGCCGGCGGCAATATTTTGGAAGTCCGAACGCGTCCAAGTTCTGTGACAAGTGCAAGGAGTTTGGACATCTG
ACGGAGAACTGTTGGTCGGACATCGAATGGGACATCCGACGCACTTCTGCAGGACTCGTCCGTGTGCGATCTGTAACCAGTTTAACGAAGGCAAATGTGG
AGAGTGGAAGGCTTTCCAAGCGATCAAGAATCTTGCACGTCAAGGAGCACTGAAAGATCTGCCGTCTCCTATCCGGAAGCAACTTCTGGAAGGGAAGGTG
GATCCAGGGGAACAGCCGTTAAACTAGTAAGCCCGCTGGATGGGGATCCAGAACGCGACGGGCTGAAGAAACCGCCCGATATGTGTCTTCTAGTGTATGT
TGGTCCGGAGTTGAGACGCCAAAACCAAGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTCGTCCTGAACGA
GTTCTATCGGAAGGTGTACGGCCGGAATACAAGATCCGGATGTACCTGTTGAATTCCGATTGGGGCCAGGCGAACGATATGGCTGGTGGGAAGATCACTG
TTCGGATGACACGAAACGGATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACAGACATCCTTTTGGATTCTGGAGCGTCAGTAAGCATGGTGAGT
TTGGATCTTGCGCGTAGACTCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTATCTGGACGGTGGCGTTCCGACCATCATCACCGCGAGTGCTGAA
GTGAAAATCACTTTGGGTCCGAGAATTGTGTATGTCTTGGAACTTGGGTCGCGAACATTGGTGAAGGTGTCGACGTGTTGCTTGGAATGAATTTCATGTA
TTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATCATTACCACAGA
GGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGTCCAGGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAATCCACAACGTG
ATGTGGTATGGGCTGGTCGGGGAGACCGATGGGTAACCCAGATCATCTATGCTGCTAGATCGTGGGCTGTGGCCATCAAAGTGGTGAATTTCCGGAAGGT
GTCTTA