Description :
From Genome Similarity Track
Location :
scaffold_197:4152- 6546
Sequence
2394 bases(100 bases per row)
ctgagccaatggacctCGGCTatgctgaagaagagaaggGAGAGCTTCGAGGtaccgagcagcgtttaacacccgacggtgttttgtctgtggtgacacc
cgtcaccttcagactggttgtcccctgtgcaaggcgcgtaaaagtTCATCAAACGACGTTCCGCTACTAACTAGCACGGAAAAACGAgaaaacccagtag
gcgcggggcgcccaactggggaagaactgagatcTGTCGTGCCTCAAAGAAGTAGAGGGCAGCacggcccagccccgaagagctcagtGCTCTTGTACAC
GGaacatgtatgcaagccgggcttgctggtcgtataaGCGaacgtgaagggctttgaaaagccacaGAAGACcctgatcgattccggggcgttggGCAAT
TATGATTGACGCACCAcgattgaaggaagtcagccatatgctaaggcgctgaaagcgcggttgagtacGCCGTaattgttcgcttagcgacaggTACTTG
TGTCATTGtgtcgagggtccctgtggacatctgcgtcaagtttcttgactttaatagcgtggaacgcttttAGTCTtatacttggatgcaaggtatgacc
ttatccttggtgtgGCGTGgttagaacaccatgagccataaatTTATTGGAGTTCGAAGACCTCGGGCGCTACGCACAGGTCTCCTAGTAGAGCTTTGGT
AAGCCATGAACTCACCTcggctaggaagcagaagcgctattggcgcgggcgcTGAACCagaacggtcaatgtgctcgatatcggagtatgcgaattgtcg
aacaccaaaggtgtttcggacaggagtcccgagcatggctcgcctgctgaacgtggagtggtacgtaacccactgagcgctgctcatgtATTGGAGCAGC
CGCTGCAAGCCAAGATTGGCATGGTCGGTCAAGGgatgaggcatcgagggcaaagccctagtgatgcacgtggagtggcacgtaacccccTGAGCACTGT
TCGTgttacaaagcagttgctgcatgccaagagtggcttcatcggacgaggtccgaagcATCAATTACGAGGCCtcagtgatgcgcgtggagttgcacga
ctgagcactgctcacgttccAAAGCAGATGCTGCATACCATGCGTgatatggtcggacgaggtccgaggcatcttggtcgaggcccttctgatgcgcgtg
gagtggcgcgtAATCCATTGTACACTACTCTAATTTTAGAGCagatgctgcatgccaagagtggcatggtcggacgaggttcgaggcatcctgggctagg
ttcttctgatgcgcgtggagtggcacgttatccactggacgaagactgcagaaaaggcagctcttcgtcgaatgttgttaataacatcaaagctCCGATG
AAGCaaggagtggggacactggacgacgccgagtgcgtgttcccactggtctcgatgagatgatatctgcaaaacgaagggcgtcgaccctgactcagga
cgtgtctaccgtaggcGGTAGCGTACAGCCATAGactcttgtcaacggtagacTAGAGAGAAAGACGGAGACGGCACCCTCAAGGAtgtcccgcggtgga
tgctcttctctAGCTAGATgaaatgtccttcgaagagtttggcagtgccttggggcaggcgatttagccgaagtggtcattgtaagaccaaacgaggaga
tGAAATTGTCGTcccttctggatgaagctgttctggaggacaccaagagagtgctgaacacacgaactggatcgtcgatcctaaagGATCGCTCGGatct
gtactatcctttgaaaaggaaatttcaagaaatcgtctctaaagacccgccgtcggtcctacatccggaccgaggtgtgagtcatgagattgacctggtt
ccgggaaccaaatactgcgtaacacgctaatacccctgcccaaagagcagtgagACACCATTGTCGTCTTTTCCGtgagaagcacgacgcaggaatggtg
tgtgagagcaagtctccccattcgacacccaaggTTTgtccccggaagccgaacggcaagtggcgtatcgttcacactcataataagctaaatacTACCA
CCATCTTAACACAGACTCCGACTTCTAGAAAAAAATTCATCAGAACagtatggttggctgtacaaagtacaggcactcgacttggtcgattgctcatgag
agcgagtgatattccgcagaCAACGGTGAGTAATCCAAGCGGGATGCcccgggagtggctggtgatgccacaagggctgtcaaatgcaccagcaacatct
aaTCGTTTTGTGATGcaattgtttaggccccattaggcgtatgcacaaacatacttcaacgacatctttgtccacagGCGTGCGGGGTATCGGA