Description :
From Genome Similarity Track
Location :
Scaffold_830:4152- 5304
Transcript NameFunction/comments
Phymu_g12096hypothetical protein
Phymu_g12097hypothetical protein

Sequence
1152 bases(100 bases per row)
CTACCAAAGCGACAAGGGCGATCTAGCGTGCGCGAGGGGTGCTTCAGATGCGCCTCAGCGAGGGGGAGACGATGGTGTGCGCCAAGTCGGTATCGAAGAC
CTAGGGGTGACAGGAGGATCACGCGAAAGTGTCCCGACGGATCCCAAGGTCCAAGATGAGCTGGATCAGCACTCGGGGACATGCGCAGGGGAGCCAAGGA
CCCCGAAGGATGGCTGGAGAGCTGAATGTATCGCGCCAACGAGTGGTCCTGCTGTTGGAACCGCCGGAAGATCGACCCAAGTGACTGCCGCCTACAGACG
GGATCCTGGGACGAGGGAGCCGGATCGCGTCAACCGTCTGCCAACCAACGATCGTCCAACAGTGACGCCTGGCGATGACCCACCGCCAGACTCGGGGCAA
GGTGATTCAGCAAACGTCTCTGACCAGGATCTCGAGGTTGGAGCCCGACCGGATCTCGTGGCTGAGTCCCAGCCGGATCTCGAGGCCGGGTGCCAGCCGG
ATTCCGTGGTTGGATCCTCGGATCTCGAAGTCGGATCACAGCTGGAACCCGTGGCTAGATCTCCGGACCCTGAAGTCGGATCCTAGCCGGAACCAGTGAT
TGGATCCCCGGATCCTATGGTCGGACCCCATTTGGATCTCGACACGGATCTCAGTGCTGCGGATGGCAATGCCGACGAAGAAGTGTTCGTTCACGAGAGT
GGTAGGTCCTATGCGGAAGAACTCGAAAAAGAGACGGTGTTGTATGAGGTTGGTACTATTACGGTCGAAGTGAAGATCGAGGATCTCCAAGTGGGGGATT
CGGCCTCTAATACACCTGAAGAGAACCAGCGTCTGGTGAATGAGATCTGGAAGTACAAGCACCTGTTGATTGGGAAAGGCAACGCCTCGCCTCCTCTTGC
GGTGGGAGCAATATGACAAATTGATGTGGGAGACGCGAAGCCGATCGCTCATTGGGTGCGTAAGGTAGCACCACAGTATCGCGAGATGCTCTCGGATCTC
ATCAAGGGGCTGCTGCAGGCCAAGATCACCCAAGTGTCGACGTCACCCTGGGCATCACCGATTGTCGTGATCATTAAGAAGAACGGAGTCGACATCAGGC
TACGTATTGATTACCGACTGGTGAATAGCTTGACGAGGTTGATGGTCTACGC