Description :
From Genome Similarity Track
Location :
Scaffold_125:41517- 43590
Transcript NameFunction/comments
Phyta_totarag4126hypothetical protein PHYSODRAFT_313163

Sequence
2073 bases(100 bases per row)
GGCGCAGCGAGAGCTTCTGCACGACCTCGTGGAGCGCAGCCGCGAGCGCGTCGCGCAGGTGcgagctggcagcagcctggtccacgtgctgcagcagcag
cagctgcacgctcCGCCACAGCTCCACGCGTCGACGTCACTGCCGTTGCTGCCTCCAGCCCCGACACTAGCGCTCGTGTCCAAGCGCCGCACTCACAAGA
GCGTCAATGCAGAGCCAGCAGTAGACGGAGACAAagctcgacgacggcgtggtGCACTGCCGCGACTGGCGCAGgacgtcgtgcagctgccgGAGGCCTC
CACGTCCTTCGAGCAGTACCAGAACTTCATGGCCAACAAAATCTACCGAGAGGAGACCGCGAACCTGCAAAACCGCCGCGCCGCACTCGTCCCAAAGGCA
GATCTGCTCAAGAAACTGGCCTTGgtctgtgctgctgctctgaaAGAAATGGAGAGGGAAGAGGACGCCCCAGCGGCGAGCGAGTCGCTGCGGGCGAAAC
TCGTGCGAGCGATGGGACTGCTGCGGGGCGGCTGTGCCTTTGCGAATGCCAAGTCGCTGGCGACACCGCCTCCTCCGTTGTATGGTGAAATCAAGAACGC
ACATTTGGCCTTCCTGCAATTCAAGAGCGATGGAGAGAGCTCCACCAAGCACAAGCGTGTTCACCCGTGAGTTTCAGCACTTCTTTCTACCTCCTTTTTG
TCTGTCATGGCTTACACTCTTACCTTCAACTTCATATCAATCTGTAGGAGTGCTGGTCTCCAGGAAGGAAACACATCGACCAAGACGCCCATCCACTTTG
GCGACCAGATTTGCTTACTGTCATCCAGCTCCGACTTGCCCCTCGCTGTTGGGCCCGACGGCCGCAGTCGTCCCGCACAAGACAGCTCTGCTGGACCACA
CATGACGTTCACCATTGTGCGTTGCTGTTTGTACTTGTATTTTTCGTTGGGCATAAGTCGGTGGCTGACACCGACTCCATTTTGCTGCTCAGGTGGACTT
CCGAAACCCGTCGCGCAACGACGAAGTTACCTCCACAGACGATTTCTGGCTCCGTGTTGACCTTGCGGTTCTAGCACCTCGGAAGTTTGACCCTCGTCGC
CCCTGTGTCAATTCTGGACATGGTGAAGATTCGGACCCGGCAGATGAAGATGGGGACGGTTTAGCCTCGCTTCTCAGCGACACGAGTTACTATCTAGGCT
GCCCGGGTTGGCTTGATGATGGAGAGTCCAACGCAACTCCTCAGCAAGAatcatcgacatcgacaCAAAATGGGAGTGCCTCAGCTagtacagcagcaaa
cgcaagAAGTGCAGAAGAACCCCGGCTGCGTGAACAAAAATGCTTTCGCTTAGTGGCCATGAAAGCCTTGACTCCTTCAAAGGAATACTACGGAGATGAC
GCGGCTACGCGCGAATATGCAGCGGAAACCAACGAAGGTATCGTGCGTTTGGCACGCTGGCGATTTGTGAGGTACAAACCTCGGAGACACGAGCAATTAA
CTGGAAAGACGGAAAATGTCCGTGGTGGCGGTTGTGGCAGCGAACAAGACGTTAATGATGCTATGGTGAATTGCTCGACAGTGTACCTCGTACTGAGTGG
CTTTGCTCTCGTGTATGACGAGGGTCTCAAGCGTGGCGTGGGAGTGCAAGTGTCTCCAGATGCACATGCATCACCTTCAAAAGTGTTGAAACTCCACGAA
AATGGCCACAACAAGAAGACATATCAGCATCACCGCAGTGATGGTGGAGTGATCGCGAATGTTGTACACCTTTCAGTGTGTGCACGGTGGCAAGTGCGTA
TTCTACAGCGCACCGGTGGCGTCAACTACTTGCAGGAACTGGAATTGGCCATGGCGGCTGTCACAGGAGACTATCAGAAAGAAGACGGTGCGCGTGTGGA
GTGGTTGCGCGAGAAGCAGGATAAAATGGCTTCGAATGATCGCCGATTGCACGCTAAGATTGGACTAGTACTCGATGCTCGACGCCAATACGACCTCGTT
GCAGCGcaaagcaacagcaaactaGAGCAAATTGAACGGCAGAAGGGAGCGCAAGCAACAGATTACTTTAAGC