Description :
From Genome Similarity Track
Location :
Scaffold_49:41512- 43735
Sequence
2223 bases(100 bases per row)
GTCGGTCGCTTCGGTTCGTCCCAGCCGGTGCCGGCGCCGTCGAGGCCGTTAGAATAGAAACTCACTCACCTGCAGGCTCAGCGGACTCAGCTGCGACGCG
TCCTGCTTCGGGTACGCCTCCCAGAACGTCCCTGGCGGCGGGTTCTCGCCTATCCGCGCGCTCACGCCAAGGTTCTCGCCGTTGCCTTCCCACGTCGCCG
CACCGGGTGCCGTCGCCGCTCGCTGAGCATCCTCGGCCGCCTCCTGCTGTGCTCCGTCGTGGTGCGCCGGCGACGCGCCTTGGCTGCTGGACGACGGACG
GTAGTACCGCGGGTCGGCGTACCCCGACGCGTACTCGGTCGACGGGTCGTACTGGCCGTACGCGGGCTGATACCCCGCGTACATCTGCTCGTGCACGGGC
GAGTGCTCGCCGGGGGGAGTTGGCAGCCCCGGCACCATCGGCGCCGCGAGCGCGGCCGTCATGCTCATCTGCGGCGGCACCATCAGCCGGCTCTGGCCGT
ACACCTCCGTCTTGATGCCGTTCTCGTCCGCCAGGATCGGCGGCTGCAGCTGCTGCTGCTGCTGCTGCTGCATGAGCTTCTCGTGCAGCCGCATCTGCTG
CAGCTGCTGCTGCTGCTCGAGCTGCTGCACGGCCTCGACGTTGTGGTGCTGCAGGTGCTGCTGCTGCTGCAGCAGCTGCCGCATGAGCGCCGGGTTGTTG
GCGTACGCCCCCATGGCAGCGCGCGCCTGCTGCGCCGCCGCCTGCTGCTGGTTCTTCTTGTGCTGCGCGTGGGACGCCGCCGCCTTGGACGGGTTCTGCT
TCAGCGACTTCCACCGGATCTTGACCGAGTCCTCCGTCCGTCCCTTGAGAAGCTGCGCGATCTGCGACCACTTGTTGCCCAGCCGCGCCTGCGCGCTCAG
GATCACGGCGTCCTCCTCCTCCGTGTACGGCCCCTTGTTGATCGCAGGGTCCAGGTGGTTCTTCCAGCGCTCGCGGCACTGCTTGGGCGTGCGACCGGGG
ATCCGCTCTGCGATCTGGCCCCAGTTGTTGCAGCCCTGCGTGACCAGGTACTCGAGCACCTGGTCCTCCTCGAACGACCAGTGGCCCTTGACCAGACCAG
GCTTGAGCACCTTGCGCCACCGCTGCAGACACTGCGCGTGGTTGCGGCCAGGCACGAGCTCGGCGATCGCCTTCCAGTTCTTCTCGCCGTGGATGCGCAC
GCTCTCGCGCAGCGCCGAGTCCTGGCTCTTGGTCCAGCGCTTGGTCGTCGGCGCATCCGGGTCCTCGCCATCGTTGTTCTCGTCCGTGGCTCCCGACTCG
GCCGCATGCCCGCCCGACTCGTGGTCGCCTCGCGACCGCTGCAGCGGCTTCTGCTCGCCCTGAATCAGCTGGCGCGAGCTCTCGGGCCGGTCGCGCTTAG
CGGTCGTGGCGTCGCCGTCGTCGTCCTCATCGCCGCCCTCCTCGTCGATGCCCGCGCTCTTGCCGTCGTACCCCTTCTTGCTGAACTCGAGCTGCCGCAG
GTTCATCTCCGAGTCGCTGATGTGCGCGTTGCCCAGCAGCGCGCCGACCTGCGAAATGTCCTCCTTGGTCACGACCGACGACGACGAGAGCGACCGCGAG
ACGCTCGACGAGCTCGAGAGACCCGCGAGCGACGCCGCCGTCAGCTCGGCCCCGTTCGCACCTCCCCCCGCGTTCTCCTTGCTCCTGCAGTCACCATAAC
AACCCATACAGTCAGCTCTTGTGTTGTTAAGTATGTTCAAATAGGGGGAGGACGCACCCGACGATGGCATTGGACGAGTGGAAGCGGTTCGCGCCGGGGT
TGAGCAGCTTGATGCGGTTCTTGGCTGTGTATAACCATAGTAACAGTCAGGTTTCCCCTCCCACATACATTGCGCGAGTGAACCCATTCACCCCCCCCAT
CTCACATGGGCCGCACCTTCGAGCTCCTGCTTGCGCTTGAGGAAGGACGCCATGTCCTTCTCCTCCTGCGCGACCACCTCGCGCAGCTGCTGCTGCTGCA
CCGCGAACTTCTTGCGCAGGTTCAGCAGGAACTTCTGCTTGCCCTCGACCGTCGACTCGGCCATCGCCTTGATCACGCGGAACTGCTTCTCGTCCCCCAG
CGCGTTCACGTAGCGGCACAGCTCGCCGCTCTCGCCGGGTGAGAGACCGCTGAGCGACATGAGGAAGAGCTTGGACGCGTCACTCGGCAGCGACTGCAGC
AGCTGACCCAGCAGGTCGCCGAA