Description :
From Genome Similarity Track
Location :
Scaffold_138:41501- 43860
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_138-fgenesh-gene-0.7SNF2 superfamily RAD5 protein

Sequence
2359 bases(100 bases per row)
AACTCACACATCGTTTTGCCGACAGATGTGGGAAGAGCGGCAGTTCCGTGGCAGTGGAACTTACTACGTGAATCCGTTCGAAAAGATTGCTTCCCTGCAG
CCGCCAGTGCCACCCGCCCCGTGTTTAGGTGGCATCCTCGCTGATGATATGGGAATGGGTACGATACGCTCCCCACCATTTTGTTGCTGTCCTGAATGCG
CATAGCTGACAACTGACATTGTCTGTACCCTCCAGGCAAGACGATGATGATGCTTTCTCTGATTGCTTATCGCAAGCATTTTTCGGATGTCTCGATTTCC
AATAGTGAAGACGCAAACGCGCGTGGGGATGAATCGACTGAGAGCACCAGGACGCTGATTGTGTGTCCTCTGAGCTTGCTGCACCAGTGGAAAAACGAGA
TCCAGGAGCGTTTCCGCGCAAACACTCTCAAGGTATACGTTTACTACGGCGACGAGCGCGATAATGCTCTATCGTCGCTCAAGAGGAGTGATGTCGTGTT
GACGACGTATGGAGTGCTCTCGACCGAGCACGAGCGAACAGCAGGGAAGAGTAATGAAGGCGTTTTGGCCAGGACGAAGTGGAACCGTGTGATCCTTGAC
GAAGCCCACAGCATCAAGAACCGCATGACCAACTATTTTCGTGCCTGCTCGTCGCTGCAAGCCCAGCATCGCTGGTGTTTGACAGGAACGCCGATCCAGA
ACTCCCTCGACGATATCTTTTCGCTGCTTTGCTTCCTTCAATATGAGCCGTGGTCTCGCGTGGCGTGGTGGAAACGTGTGATCTCGAAGCCGTACGAAAA
TGGCGAGGATGCAAGTGCACTCGGTCGATTGAAAGCCGTTCTGACCCCAGTCCTGTTGCGACGCACCAAGCATTCCAAGGACAAACAAGGTCGACACATC
GTGCAGCTGCCGCCGAAGCACGTCGAGCTAGTGAAACTCGAGTTTCCCCCCGATGAGCGCGCGTTTTACCAAGCGGTTTATGATAAGAGTCGCGCCGAGT
TCAATGGATACGTGTCAAGCGGGTCAGCCATGTCGAGCTACGTTGCCATCTTTGCGCTATTGCTACGTCTACGCCAAGCGTGCGACCACCCTCTCCTCGC
ACTCGGCCGAAATTTTGAGCAGGTTGCCAGTGTGTCTCGTGACGGTGGCGAAGGTGGCAGCACCGGGTCAAGTTCGTTGTCGTCGCAATTCCGACCGCAG
CCGAACGAAACCATGGAGTCGTACTATAGCCGCATTTCAGCGCAGCTGCAACAAGATATGAGGGCCACGACAAGCGTCCTCAATTCGCAGCAGAAAATGA
CGGCAGATGGTTCAACTGGAAATGGCGCAAACGACCAGACTGATCACTCTGGCAGTGGTGGCGGACTGACGAAGGCTTACATCGACAGCGTCATGGCTCA
GGTGGAAGACGGACTCGAGTCCCAGGAATGTCCGATCTGTCTCGATCCCCCAGTGAATGGCGTGCTTACCCCATGTGCACACCTCATGTGCGACCAATGC
TTGCGCGACTCGTTGGCCAATGATCCTGAGAACGGGTGTCCAGTGTGTCGTACAGCCGTGGACATCAGCAAGGTGTTTCTGCTGCCTTCTCCACCTTCAC
TTGGGCCGTCGAGCCCATCCACACAAGTCAAGGACGAAAACACCATGACGACAGTCACTGATGCCACGACGGGTTCTCTGACAATTGCAAATGACGATTC
GACAGCTATTTCGACTGCAGAGAGCGGTACGAGGTTCCTGAGCTGCAAGCTTCGACAGCTCGTGCGGGATCTGGAGCTCATCCGACGAGAGAACACTGCT
GCCGAGAAGAAACGGAAAGTGGTTGTGTTTTCTCAGTGGACATTCATGCTCGAGATGATTGCTGATGTTGTTGGCAGCCGCGGCTTTGGCCACTGCATGT
TCCATGGCTCTATGAGCCAGGAGAAGCGTGAGCAAGTCCTGACCAAGTTCGCAAAGGATCCAGCTATCGATGTGCTTGTAATCAGTCTGAAGGCCGGTGG
CGTCGGTCTAAACTTAACGTGCGCATCCGTGGTGATCCTGATGGACCCGTGGTGGAATCCGGGCGTCGAGGAGCAGGCGATCGATCGCATTCATCGTCTG
GGCCAGACCGAGGACGTGATAGTGAAGCGCTATGTCGTGGATGAAACGGTGGAGGACATGATTCTCCAGCTGCAACAGCGCAAGGAGAAGCTGGCGAAGC
ACGTGCTGGTGGTGGCTAAGGCCCACGAGGACAAGCGACAAGAGCGACTGAACCTGGACGATCTGAAACGTTTCTTTCAGTAGAGCCGGCGACGAGTCGG
CATGTTGTAATCTGTTGTAGTGGAGATGTCCATCTCGCGTTTTGCCGCTGCTCAAATGG