Description :
From Genome Similarity Track
Location :
Scaffold_1124:4150- 8472
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1124-fgenesh-gene-0.3Phospholipid-transporting ATPase

Sequence
4322 bases(100 bases per row)
TAAGGCATGTGCCTGCTGATGGAGTTTCGCAGCGCCGCCGGCACGGCGTCCGAGCGCGGCAGCGAGTTGGACGCGATGTACGACTCGGCCAGCGTCGTCT
CCTCGTCGCAGCTGAACGCGTAGCCCGTGTTGCGCCGTGAGGCGCTCGTGGTCTTGAAAAACTTGGGCGCCCACGGGCCGCCCGACGCGCCCAGGTCCTC
TGTCACGGACGAGCTGTACACGCTCGCCGAGAAACTGTCAGCCGTCAGCGACACGTTGTCCGACACGCCTCGCGTAGACGGGATCTCATGCTCCTCGACT
GCGCTGTTGCTGTTGCTGCGGGCATGAAGCAGCGTGCCGCCCGAGTTGGTGCGATACGATTTGACCGTGATGTCCGTGCCGCGGAAGTCGCTCATGAACC
CCCCCGCGTGGTTCACGTCGTCTAGCGACATGGATAGCGTCTGCTCCTCCACGTGGTTGATCGTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTTCTGGCGCTTCTCGACCGACTCAGACAGCACCTGGTTCAGCTCCGGGTAGAA
CGTGCGCTGGTACTGGCTGTACGCAAAGTGGCGGCCGAGCGCGATGACGCAGCCCATGATCACGACTAGCACGTAGCCCCAACTCCAGGCCGTCGGCAGG
AAGCTCCCGAACTCGTCGTAGGCGACCTTGAACTTGGAAAAATATGCCACCTCGGTGCCCATCGTCGCAAAGGCGAACCACGAGAGCACACTCAGTGACC
AGCATGTTAGCGATAGCAGCGTCCACGTATCCGAGATGAGCCAGATCTTGAGGTTCACGATCAGCACGGTCATGGAGAACGCGACCATGCCGTACTCGAC
GCGCGACTCACTCCCCGGGGCGTTCTCCGACGCGTTGAAGCCGAACGACATCACGATGAAGATCACGAGCGACTCATACACTGCGGCGCCGACCCAGCGC
AAGAACGTGTACATGTTGAAGTAGTACCGTTCGGGGCCCTTCCGATACAGATCCGGGTACTCGAGGCTGAAGCTCGCCGGCAAGTCTTTATCCATCACCC
CGACCACGATGATCGGCAGACCCGTGAATGCGACGTTGTACACCTGCACACCCAGCTCCCAGTACATCTTGGAGCCCGAGGCGCCCGAGAGGTAGCCGTA
CCAGTACTGCGCCAGCACCAGCGTGATGTTCTTGTAGAACATGTACAGCACGAGCTTGGAGATGCGGATGTAATTCCAGCGGCCGTGTACGAGCAGCAGC
CGTTCCAGAAAGCGGAATTGCGCGATCGCATAGTCGCTCGAGTTCACCGCCTGCATACCTTCCTGTCCAGAGATGCCAACGCCAACGTGTGCAGCCTGAA
TCATCGCCACATCGTTCGCGCCGTCGCCAATAGCGAGCGTTCGTGCCAAAGGGATGTTGTCGCGCACGAGACGCACCATCTCCGCCTTCTGCGCAGGAGA
CACGCGGTTGCAGATCACAGCGCGACAGAGCTTTGCGAACCCCAGCAGATGTGGCGCCGTGCGCACACTGAGCGCCCATTCCAGCGCTTCACCGTCGATA
ATCAGCGAGATCTCAAGCTTCGGGTCCGCCTTTCGCCTCTCCTTGTAATCCCGCGCAGCAGCATTGAGGCGCGCGATGATCGCCTCTTCGTTCGGACATG
TCGTGCAGTTGACAATCACCTGCTGGATCGAGTTGTCCAACAACGAGCACGCGTACGCAATGTTGATCGCTGTCTCCTCCTTGTCGCCCGTGAGCATCCA
TACTTTGATTCCCGCTGCCGTGAGGTTCGCCAGGCACTTGGGAACGCCGTCCTGGAGCTTGTCCTCGATCGCCGTCGCGCCGATGAGTTCAAGGTTCTCC
TCGATCTCCTCCATTAGGGTGTCAATCGCGTTCGGCTTGCCGTCTTTTCGGCGGTCGAGCTCCGCGACGTTGCCCTGGGCCTCGTCAAACTTGATCTTCC
ACTTCTGGAACCACTTCTCGTCGAGCTTCTTGACCGCGAGCGCTAATGTGCGCAGACCATCATCTGCGTACACCTCCATGTGGCCGTGCGTGATCTTCTT
GAGGCGGTCGATGGCGGGGTCGTCCTTGAGACGCTGATAAATCATCATATCCGCACCTTTCGTGTATAGATAAAGTTCTCCGTTCGGTCGTCTCACCACG
ACTGACATGCGCTTGCGCGTGCTGTTAAACTCGAGCACATCCAGTACCTCGAACACCTGTCGCTCGCCCAGCACTTCGACCGTCGCCTTGCCGACGCCGC
GATTGATGAAATTGAAGCCTGCGAATGCGGCGCCCGCGACCAGCGCTTGCTCATCAGGTGATGACGCCGACAGACGCACTTCACCGCTCTCGAGCTTCTC
TGGGATGACAGTGTGGCACACGGCCAGGTGCTCGAAGAACTGCGTGATCCGTCGCTGCTGATCCGCGCCTGCACTGCCTTTGAGCGCCTTAAAGAACGCC
GGGTCGACAAAGTTCACGTACTGCATGCTCTTCATCCCAGCCTCCATCTTAGGCTCGTGCGGAATGGGCTTGCCAGCTCGCACGAGCGCGGCGCGGCCGA
TCTCCGTCATGCCCGAGCCGTACGAGATGCCGTTGATCGAGCACTTGCGGAACTCCATGATGTTGCACGTGAGCGTGCCGGTCTTGTCGCTGAACACGTA
CGAGATCTGGCCGAGCTCCTCGTTCAGCGCCATGGTGCGCACGATCGCGGGCGTGTCGGTCTCAGCGTGATACATCTCGCGGTCCCAGACCATGAATTTG
GCCTGGAGAAACTTGACGCTCGTCATGGACACGTAGAGCGAGATCGGGATGACCTGGTAGAGCAGCAGGAAGTAGTAGAAGAGCATCTGGATGAACGACT
GCCAGCGCGGCTGCGCGCGCACGTCGTCGCTCAGCTTGATGTACCACGTGTTGCGCACGATGTCGTCCTGCCACGTGACGTAGCACGTGGCCGCGACGGC
GCACGCGACAAAGAGCCCGAGGCAGAGGCAGCCGATCATCTTGTTCATCGAGAGCATGACATCGCTCCACTTGGATGGCGCCCCGCTCGCGCTCTGCATG
ATCTTTGTGTCTGGGCCAGTGTTGAGCACGAGCGCGTAGACCCAGTCAGTGTTGCGCAGGTTGCAGCCGCGCAGCAGCACGTTCTTGACCGAGAGCGGCA
TGACCTCCATGCCGCAGCCCTCGCTCACCGTCACCTCGACCTTGCCGGCGAACTTGTTGATGTACGGGTTGGGCTTCTCGCACTTGACGACGCCGCGTAG
CAGCATGAGCTCCTGCGGGTTCACGAGCGCGCTCATGGTCGGCTGGATCGCCTGGCGCAGCTTGAGGTTCGTCTCGCCGTCGAGGCTCTTGGTCTCGACG
TAGCAGATGCCGCTGGCGGCCTCGCCCACGGGCTCCGAGACCGCGAGGATGAGCACGTCAGCCGGGATGACCTCGCGGTTGCGGATCTGCAGGAAGTCGC
CGACCTTGACGTCCGACCAGAGGTGGTCCTCGATCTGGCCGTTGCTGCGCACGATGTGGCACTTGGCCGAGTTGGCTTCGTTGTCCGACTGGTGGCGCCG
CATGTCCTCCATGATGGCGAAGACGGCGTCGATGGAGATGACGAAGAGCAACACGGGCGCGTTCGTGGGCATGCCGTACGTATTGCTGATCGTCTTGATG
GACTGAAGCACGCAGACGACAAGGAAGAAGAAGTTGGCGACCTTGGAGAAGCTCTCCTTGAGGAACTTGGGCAGGAACGTGATCACATTGTACTTGGACG
TGATCACGACGTTCGTGGCCTTGTCAAAGGCCGCGTTCCCGGGCCCGTAGTTGAAATAGACCTCGCGCAGCTCCTGGCGCGCGGCGTCCTCGGCCATGGT
CATGGTCGCACTGCTGCTGTCGATCGCCTCCTTGCTGCTCGTGCGCGCGCCCTTCCCCGGATGCAGGCCCGTGGTGCCGCCCGTGAGTGTGCGCTTGGTG
CGGATCTGCAGCTCGTCCGAGGCCGCCTCGCTGCCCATCAGGCGCTGGTTCTGCAGCAGCGCGGGGCTCTCCATCTCGGCGTACATGTCGCTGCTGCTGT
TGGGCTGTTTCGCCGGGTGGTGGGATGCCGGCGCCTGGTGCCGCAGCAGTTCCTCATCCTCGACGCGCGAGCCGCCGCCGCCGAACAAGCGCACCGGCCG
CCGCGGGCTCTTGGTCGCCATG