Description :
From Genome Similarity Track
Location :
Scaffold_1419:415- 3608
Sequence
3193 bases(100 bases per row)
CCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCGCAGTTCAGATCTGCCTT
GTCTACCCAACTCGGCTCGTCATATCCGCGCCAATACACTAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGTTTCCATGACCTCATATCGGTGATC
CTCTCGACTTCGAACTCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACGCGGTCGGATACATCCACTGAAA
GACGGATCTGTGGCCGATCCGGATATTCTTTGACCAACGTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTT
TACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGTGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGC
CACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGG
ATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCAGGGT
GGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAACGGGAGCCGTTCTGCGTACTC
ATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATAT
GCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAACGCCTGGCTCCCGATCATGTCTTATAATCTCACTAG
CCCCAAATCTTCGGAAAAAGCACTCCTCGTACGATTCGGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCAGTAAACAGGTC
CACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATCC
AGGTGACTCCCCTTCGATTGTGGGTCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGA
CAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCG
GCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTTTATCCGTAT
CTATAATGCTGTAGAATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAAAATCCACGCTTCCTCGTTCTGTGC
TTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATTACC
TGGACTGTTCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTTAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCCC
ATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCGCGCAGGTGGAT
CATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGC
CTTTTCGGATCTTGTCCCTTTAGTAAATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGCTAACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCC
GTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCACTGTACGCCTCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATC
CTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGA
GTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCTCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCA
AACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGGTCTTCCCACTAGCAGGTTATAATTCAGATC
CAACACGCGCAGGAGCGCGAGTATCCCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATAGCAGATC
CCCTCATGTTCTTGAACCAGAACTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTCGACGTTCCGGATCGAAATGACAGAGGAAAGGGA
AGGGGGGGGGTCCGCAATTTGTTTTCCTCCTTTTCCCCAAAAAGGGGGGTTGGAATTGCGAACCCCCCAAAATTCGCCGGTTTCCCGGTTTTGGAAACCC
CCCCTCTTAACCACCGGAACTTTCCTGTTGGTCCGGGGTGGATCAGCTCGTTTCAGTCCTCTCGGCGTCCTACCACTGGATCCCTTCGTGGATCCGGCAT
CTCCTGGGCCAGAGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGG
GCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACA
GGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACCCTAA