Description :
From Genome Similarity Track
Location :
Scaffold_3763:415- 1879
Sequence
1464 bases(100 bases per row)
GATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGAT
CTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAAC
CATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGACCCCTGGATTACGGTAG
GTACCCATTTCTCGCCCCGAGTAACCCACAGTTTCTCAAGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTTCGGGCTCGATCCAGGTCGT
CTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCT
AGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAAC
AACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCA
CCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTG
GCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATC
CAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCACCCAATAACCACGTGCCTC
TCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGGAGATCA
CGTGTATTATCGAATGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTTGTACCG
GATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTG
TAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACT
TCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCACTGCGAACA