Description :
From Genome Similarity Track
Location :
Scaffold_20:414946- 420199
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007908Similar to Wdhd1: WD repeat and HMG-box DNA-binding protein 1 (Mus musculus)
Pytul_DAOMBR144PYU1_G007907Similar to PDCL3: Phosducin-like protein 3 (Homo sapiens)
Pytul_DAOMBR144PYU1_G007906Similar to gatC: Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Nitrobacter winogradskyi (strain Nb-255 / ATCC 25391))
Pytul_DAOMBR144PYU1_G007905Protein of unknown function
Pytul_DAOMBR144PYU1_G007904Similar to COMMD2: COMM domain-containing protein 2 (Homo sapiens)

Sequence
5253 bases(100 bases per row)
GCGATTTGTCGGCAAACTCGACCTTGACGAGGTTCTCGCTCCGGTTCGCACCGCGGATGCTCTCGATCTCGCCCATGGGCGTCCACGCCAGCAGGCACAC
GGTGCCACCGTCGTTCACGCTGCCGGACTGGAAGGGCTCCGTGAAGCTCTTGAGCGACGAGATACCGGTTGCCGCGACTCGCGACGCTGCACCGCCGCGC
TGAGTCGATGATGCGCCGTAGTCGCCATCGAGAGTGTCATTGCCGTCGTGAAGCTGCATTGCGGCCGCTTGGCCAAAGCCGAAGCTCGCTTTGATGGCTT
CAACGCGTGTCTCGTTCTCGTCGTCGTCGCCTGTTTCGTCGCCCGTGTCGTCGCCGCGGCCACCTTCCCCTGCTTCATCGTCAATGAACTGCGAGACGTT
CAACTTCTTCGCCTTTGCCGGCTGAGCTGCTGTAGTTGTCGTAGCAGAGACCTTGCTGTCAGTAGAACTGGACGAGATTGTCGTCGCCGCGATGCCGAAG
ACCTGGGGCGGCGTGCGGCCCATGGGGATCGCGTCCTTCACGAACGCGAGTTTGCCGCCCAAGTGGAACACCACGAGCGCGTTCTGCGACAGCGCCCAGT
CCACCGAGAGCACTGCAAAGTCCAATGTGAACGAGCGGATCACCTCTTTGGTCGCGACGGACCAGATAAATACCTGCTTGGCCAGCGTCGCCGCGGCCAC
GTAGTGTCCATTCGGCGAGAACGCCACGATGTTGATGTCGGAGCTCGTGCTCTTGCCGATTGGCAGCATCAACTGACCCGCGCTCTTCCATGTCGAACGG
TCGAAGAGCTCAATGATGCCTTGGTTCACAGGCACGGCGAGCAGTTCGGGCTTGTCGCCTCGCTGCCACGCACAGCGACACACGACTTCGTCGTCCTTCA
TTTTATCTTTGTACTGCACCTTGAAGAGCGCTTGCTGCTCCGCGATCATCGCCTCTGGCTTGAGTTCAAACACGCGCACCGTACCGTCCTCGCTCGACGA
ACAAATGTACTTTTCGGTCGGATCAATGGCCACGCTCTTGATGCCGTGCTCATGGCCCTCAATCGTAATCACTTGGTCCATCGCGGACCGTAGCAACACC
TTAACCGTCGAGTCTTCGTCGGCGATCGCGATGTACTTTTGCGAGCACACCACCTGGCGAATCGCGACCGTCGAGCGGAAGAGTAGCTTGTCCATGTCGG
CCATGCTGCCCGACGGCATTTTGTAGCTGTACACTGCGCTCTCTTCTTCCTGCACGACCAGCACGTGCGTCTGCTCGGGGGTCACGGTGCAGGACGGGAT
TGCGCCGTCGCAGATCACGCTCTCAAAGAGCGCGGCTTCGCGGTTCAAGTCCGTCACGTACACGACACCATCCTCGCCCGTGGTGACGACGATGTCGTGG
CCCGCAGGAGACGCGTCACTGAGCGGCTGCTTGCTCTGGAAGAGCGCCATGCTCCCCATGCCGTTGATGTTGACCGTGATCTCCTTCATGGTCTCCATGG
CGATTGGCCCTTGAAGCTGTCGCGCGCGCCGTGCAAATCGCGCTTTCACGCTTATCTATTTGAGCTTTTTCCACTTCATTATGGCGCCAACAGCCATTTT
TGGCGCGTAACTTGCCTTCAGGATCTCCTACTATAGTGTGTACCACAAAGTTCAGCGGAAAATGATTAACTGCCAATTAAAGTGGTCTATTGTATTTTTC
AGCGAATCAGCACTCGGTATCTACATTTTTCTCATGGGTAGTTCCTCTTTATTACGTTACTAGCCATAGTTTATGAGTTTTTTGCTAAGAGTGACCTAGT
TCGGTCGACCCATTGCCACATTCTCTATATCGACAGGAAGAAGGAAAGAAGCAGCAGCTACGATGGACCGCGGCAGCAAGTTCTACGAGCCCACGGGTGA
GACGACCGAGTGGGAGGACATCCTCATCAAGAAGGGCATCCTCGCGCCAAAGACCAAGGTGCAGGAGGAGGAGGAAGAGTCCGAGGACGAGCAGTACGAC
GCGCGCCAGGATGCCACGATCGACGAGTTGGACGAAATGGAGGTACGATGCTGTTATATTGGGTGCAATTCTCCCTCTATATGAATGCGACGCAGTTGAT
ATGCATAGTTGGGGGAAGAGATGTGCATGGAATATGTGATGTTTACGCACATGCTTTGCTTCTGTCTTGATGCGTTTGTGGTTGAAAACAGGATGAATAT
GACGACGATTCGGAGCTGCTGCGTATCCGGTAAGTTATGAAAATGATGTCGCGATGATAACGACACATCGCCTTATACATTTTCCCTCTTATGCGTACAC
ATGATATCAGTGAGCGCCGTATTGCGGAGATGAAAGCGCAGATGGCGCGCAACAAGTTTGGCGAGATTCAGCCGATCTCAAAGGACGAATGGACCCGTGA
AGTGACCGAAGGCAGCCAGGAGAACTGGGTCATCGCGTACTTGTGGGACGATGCGCTTGAAGAATGCAAGCTGATGGACAATGTACTGCGTGCGGTCGCG
AAGAACCACCGCGACGTGAAGTTCGTGAGCATCCAGGCGCAGGCGTGTATCGAGAACTGGCCACAGCGGTATGTGGTGTTTAATGATAATGTTGTGGTAT
TTGTATATAAACTGACTTGTGCATGCGTTTGTTGACCCCATTGCATCGCTATTACAGCAACTGTCCGACGCTGTTCATGTACCACAAGGGCGACCTGAAG
AACCAGGTGTTGGGCATCCGCAAGCTCGGTGGTTTGGATATGAAGGTCGAAGATTTGGAAGAGCGTCTCGCGGAAGCGGGGGTCTTCAAGGCAGATTAAC
TAAACGCACTGCTTAGGCGCGTAGTCTGTCATTTTGTCACTCCAAATAGATTTTTTGTATATACTGGATTGTTGCTGTAAGCGTGAGCTTGCATCGTGTT
TGCTTAATCTTGGAGAACCTTGGGCACTTTGAAGAAATAGCCCGACTTCTCGGCCGCATTCGCGAGCACCTTGTCCGCGCAATTGCCTTCTGTCACGACA
TCTTCGCGCAATGGCGCGATGCCTAACAATTGCATACATCACACGTGATAAACATTGCAAAACAATTAGCATTCGCAGATTCTCCACATGCGTAGCATGC
AGAAGTCCATAACCGCGCACCTGAGTCAAAGTCGTCCTTGGCGTAGAGGTCGTCGATGTTCTCGTTCAGCGTCATCGCCTGGATGGTCTTGGTGCACTGG
ATGATCGACTCGACGTCCTTCAGCAGCGACGGCAGCTTGGCATCGTCGATGTGCAAGTGGCAGAGCTCTGCCAACTCCCGCAGCTACATTTTAACAAAAT
GATTTAAAGCCAAGATGCAATACGTGAGTCCACTGCTAACAAGTCCAGCGAGCGATTCGTTGCATGCCTTTGCTTCAGTGAGCACGCTCTCAGATTCGCT
CACGTCGCCTTCATGGTGCAATTCCGTCAGCGACCACGAAGGATTCCTCGGAATCTAATGGTGAGCAGCAGAAGGTAATAAGGAGGCATTAAAGTTCGCG
TAGCAGCGTTCGTTAGTCCGAGTCATTTTCGCATGAGAAATGCGCCTAATTCACTGTCATCCAAGCTCTAGAAGAACGGAGAAAGCGCATCACTGCAGAG
CGCAAGCGTCAACGCACCCGCGTAATCTCCTGAAGTCCTTCTGGTAGTGCGCTGGCGGTGCTGAAGCGCAATGCACAGCGGCGACTCGCGACTGCGGCGC
GCAGCACTCGTTGCATTCCACAAGCCATCATCTTCGCCACTGACAAGCTCCAACGCTGCAAAACGTGTACTAAGTACGCAATGTGACCCTCAACTTTACG
ATTACCGTACTTACCATCTAAGTTCGTATTGCACAAAACAACAAGGTTCGCTTTCGCCAAGTGCGCGCGTACTTAAAACACTACCATTTCATCCTAACGA
GTGCACTCTAGAACAGAACGCGCCGTTGAGAGCCATGGTGAAGGTCTCCAAGATGATGTTGCACTACACGCTGCTGTTCTCCGTCCCGATCGCGGGGGCG
TACTACTTCTGGGATCCCAAGTCCGACGACGAGATCCGCAAAGACGTGGTGCGTGTGTGCTGGCTTGCTGTCTGCTGCCGCCCTGTGCAAATCATTTCAA
AACGCATCATGCCGTTGCGCGTTTCCAACGATTGTCTTTGTGTGTGTGTGCTTGTACTATATGATGTGTAGGAAACGAAAGTGAAGCCGGATTTGGAGCG
CCGACGTAAGCACCAAGCAAAGTTCGCGGAGCTGCTCATGCCAAAGCACGCGACGTCCGAGGAAACGCAAAAGCAGTTGGACCAAGTGACCGATTTCACC
CCCAAGCACCCAGGCACTAGAAACTAACTTCATCACCACCTACTTTATATATACAGCACACGCACACACTACGGTTGTTATCAATGGTTGTGACGTTTTG
GTTCGTGGCTTCTGCGTTTCCTTTTTTATTTTTCTTTGCGCTGACATTGCGAGCGTAGATGACAGTTAATGGAGGTATCGTTGTATCCGAGACGCGTGCG
TCGCGTCGACTTCGTGGAGCGCGGCTTCCAATTGGCGTTGCAGGTTACGCAGATTCTCGTAATCGACGCGCACGCAGGATAACTGACGCTGTGGCAAATC
GTCGGCCTTTTGCTTCATGGTGTCGAGGCGCAGTGTCACGAAGGGCTTGGGTTTGTTTCTCATGAATCGAGAGCCAACCTACGTGAACAAGCGCAAATCA
CCAGATTAGAAAACGCTCTCATTTTTTAACATTTTACGGCGACGTCAAAGTAGTACAGACAAATCGATCCTATCGTACCTCCAAGTCGATACGCCAGTCG
AGACTCCGGTAGCGTGGCAGGGTCGTGCCCGTCTCGCGACACACGCTTTCTTTGATTGCGTCCAAGTTGTCCAAGTACAGCTGCAAGAAGCCACACATGC
ACACACATGTTACGACATGATTCACTGTAGGAAGAATGACGGAGAGAAGCAAAGTACTGCTGCACCTTTGTAAGCTCTTCGGCATGTGCCGCTGGAAGAT
CCATCGCCTTCATTGACACCTGGAAGTGATATTCCGACAGATCCGCCTATGATATGGGCGTAAAAAACATATTTACAGCAAGTAATTAGCAGTAGAAGAC
CGATGTAATTAAGCAGGAAGCAAGCGACTCACCATGGCTGAATCCATCAAGATTTTGGCAAACGCGAGCACTGTATCCTCCGCGATCGAGTCGTCCCATC
CACACGCCGCTGCGAAAAAGACACCAACACGCACACACATCAATGGCTGATTA