Description :
From Genome Similarity Track
Location :
Scaffold_5:41494- 43568
Transcript NameFunction/comments
Albla_Nc14007710eukaryotic translation initiation factor 6 putative
Albla_Nc14007720
Albla_Nc14007730myosin IB heavy chain putative

Sequence
2074 bases(100 bases per row)
ATACTTCTACTCCAAGGGCATCTGCAACAATCTCTTCTGTATCTCTATCTAGATCCGTATGAACCAATGCAACATGATCATTGCTCACGATACAATTCCC
CAAAGCTGATAAGCGTTCTTCTACCCGTTGAACAACCACTGAATCCGGTAATGCGTTACGAATATGCTGAAACTCTTGATCGGTAGTGGTGTTTGGTAGT
AATAGTCCACGCTTGTTACCGACAGCGACACGCCCAACGAAACGGCAACCGGCGATTGATGCGTGGATCACAGGAATATGATCTGCTAGTTCCGCTTCAA
AATTGCTGTAAAAGTTCTCAGACCCACCCACACATACCAAACAATATGAATTTGTGACTTTTGAAAATACTCCTATTTCGTTGCTGTTCTCAAATTGGCA
TCGAATTGCCATAATAAAGTGTAGATAGTCAGACAAGAGTCGTAAATACAAATTTGCTTGGTCCTGAGCAAATACGTACTTAAAACGAAACTATAGGTGA
TACGTGAACTGCCCTTCAAGCAAAGAAGGAATTTCAAAGAATGACTTAAAAAAGCGTCGAAAATGTCGATAACTTCGTAACGATTTAAGAATCCAGGTAA
TGTTTTCAGAGAAAGTTGTTATTTACACCTTCCCGGTTATTGGTTCAGCTCACATAAGTATCAACCCACAATTTGATCATTTCTCCTGCAAATCTTCACA
AAATTGCGATGCACACTTGCAATGTGTGCAAATAAAGGGCAAGGACACACATAGTACTATAGGGTAAATCGTTATGATTTGAGAACTCGACCAAACCACG
TGTATCATCCATTCAATGCTCTGATAAGTTTAAAAGCGCACGAAAAGTTCTACCCATACGATGCAACTGCTTGTGTTTGCACACATATGGGCATCTCCCA
GAACCTGCTGAGTAATGCGCCAAGAAGATAAGTAGGAAGCTATGATTTCTCGTTACAAATTGAAATAGAGCGTTGTCTCAATTTCGTTTAGCATCAAGAA
TGTCTGCTTGCTCTCAGAGGTGTCTGCATCACGAATAGGCCAAATCAATGCGATGAAATCCGTAATGCAGCTGTAAATATGTCGACGCAGCGTCAGCATG
TCACTCATCCTGTTCTCAGATTGGCAGTGGTATATGTTTCTTCATAAATATAAACAGAATCATGCGCCTAATTGTTGCTGCACAATTTACTCCAGTCTAA
AATATAGACACTAGAATCACGTCTTGTGCTGTAGTAACAGTGCTGCAAGTAGGGTAAAAATATTATCAAGAGCGATTGCGCGGCGAGATCGAGTCTGTTT
GAGAAAAGTAGCTCCCGCGGGTGCCGTAGGGTACTATCAAATGCCAAAAAATCCTTTGATTAATTGTTAGATGAAGTTTATTTTTACAAGAGAAAACCAC
ATACTTGAGCTTGATAGATCTGATGCAAATTCATGACGTAGTGTGAATTGGTGTGAAATGCTTCCTGCTCCTTGGAATGTCGAAAGTCATTGATGCAAGT
GAGACAAGCCCTGTAGACGTGAAATCAGCGTAAAGGTACCAAAAGTGCATCTGATTTTCACCGAGAGGTACCCATGTTGTACTTGCCGAAACGGAACAAC
TAGTGGAAATTACTCTGCGTTACCACGACGTCGTGCAAGAATAGCAGCAAGCTCACTACCCATTCCTCCCGAGCTTTGCTGTGGAAGATCTATACTTTTT
TTGAAGCGGTCTTGGCTTGATCTGGCTTTAGCGCTTTCTGATTTCATCATCGAGGAGGTGGTCGAATTGGAGCTTTGGGTGCTCTGCAGCCTGGCTTCTC
TATCGGCTTGCTTTTTAGCTTTCCGCAATTTGATTCGTTCAATACGTTCATATTCTCGATCTTGCTCTATTTGTGCCCTGCGTTGAGCACGTTGAGCTCG
TTCTTCCTCTCGTTTTGCCTCTGTACGTTGACGTCTTGCTTTGAGACGCTTTCGTCGCTTTGCGCTATATTCTTTTGGAACTCCTCTAGGCGCCTGAATC
TGAAGCGAATTGTGGTCTCCCATGAGCTTCAACTCATCGGTACTAGTCACTGAAAATATGATCTCCTGTTGGGG