Description :
From Genome Similarity Track
Location :
Scaffold_1567:4149- 8456
Transcript NameFunction/comments
Phypl_g13726hypothetical protein

Sequence
4307 bases(100 bases per row)
GAAGTGACGATCGAAGATATTCAAGTGGGAGATCCGAAGTATAATACCCCTGAGGAGATCGATCGGCTACGTCGAATGATCTGGAAGAGGCGACACCTCC
TGGTCGGCAAGAGCAATGCGTTGCCGCCAGCCGCCAGAGGCGATGTTTGTGATATCGAGTTCAATCCACCCGCGTAGGTGTTGGAATGACTACAAGTGCT
ACCAAGcgtgacgggctgtcacacgagcacgttNtagaaagtgatacgatcactttcgagagggtaaccatgtcacccgaatgtaaccccgttacaaGCA
AGCCGTCTCTTTTACATACGGAGTTTGTCAGAGCAGTCGTCCTTGATGCAAACAGTGTACCAGACAAAGCGTCCCTCAGATGTGCACTATTGTCGGCGCC
TAACAGTCCTCCTATCGACTTTGACCGAATTAGAGAACGTGACTTTATGACATGGATCGTTTCACTGAAAAAACCTAATGGCTTCTATCATAGTCTTTCT
ACGTATGCTGGCCACCGCTCGGCTTTTTACAACCTTTTTCAAGATTATCACCGTGTTATGTCGAGCGATTTTGCTCGCGAGCTTAGCAGTCACTTCAAGG
GATACCAGCAAAAGGTAGCAGAAGCGGTTGGGCAAGGCCGTAGTCAGATCAAAGTTGGCAAGGATCCGATGCCTCTCCGCCTGTACAAGCAAGTCGCCAT
GTCAATGCTTACTAGCCCTGATATTTGCTAAAACGTTTATGATATTGTCGTGGAATTTGATGTCACGAGTGGCGAACACGGCGGTAATTTGCTACGGCCC
TTTGGAATGGCGCGAAGATGCGCTGTGTGTGTATTTAGCGCACATGAAAAACGACCAACGAGGTTCTCGGCCGCGCGACCCGCGCCATGTTAACTCTAAT
CCAACAGCTCCAGAAATATGCCCCATCCTCGCTCTTGATAAGCTACGCGTTACTGTGCGAACAGTACATTTGATTAAGCTAACTGTGCTGTTGTGCCTTT
GTGGGCATGTATTGGGCATGATACCGTGTCGACGCCACTGAAACGCACATATTTCCTGGCCATGACCAGTCCGAACGGTTTAGAAAAGTGCTGGGAcgcg
tgctcaaggcgcCGTCTATTCCAACAGAGCTCGAACGTCGTGATACGGATGCCACTGATATTGGTACCCATTCGATGCGCAAACGAGCCTCTACATTTTG
TTCTTCGGGGTCCACGGCGTGTCCTCCTGCGGTTGCTGTTCATCTCTAAGGCGGTTGCGCAATGGGAGGTGTTAAGGACCAATATTTAAGacacgatgct
gctgatgaCATGTTCGTAGGCCGAACAGTCAGTGGACTTCCGATTTTGCAGCCTGAATTTGCCATTCCACCTCCCCACTTTCCTGCTAATGATGATTTGG
ATCAGAAAGCAAAGCGGCTATGCTATCCTGGATTGCCTCAATCCGTTGAATTTCTCGGCGAGGTTGCACTAACGTCGATGATATACCATCTGGATTTCCT
CCGACAACATCTCCCAGGCAGCCATCCCCTTTTCCAATCGCCTCTGTTTGCCGATGCTGACTTAGTAGTTCATCTGCGCTCGATAGTCAAGACGGACGGG
CCGGGAATTGATATTCAGCCTACATGTGTTCCACCCCACGTAACGATCCTGAAGGAAGTTCGTGCGGCGCAAAATGCTCTTCAAAAAGTGATACATAATC
GAAAAGCATACATGCAAGAGATTAAAAACTCGCACGACAAGTTATGCGAGCGCTTGATATCCGGTGTCGCTTCAATATTGGACGAACGATCTTTTCAATC
TGGTGTTCCAACCTGTAATAGCATGGCAGAGTCGATCATGAAGAAGTTAGAGGATGCAGGGACTATTGCACTCCTACGCGCTAATGAAAATGCGGTAACT
CATAGTGAGCATTGCCAGAGCTTGGTGGCCGCTGAAGAGACGACAGAACAGCCCACCATCGCGCCGAGCGAGGAACTTTCTTCGTATCCTGTATACCATT
CGGGAGGCAACATGCATTTGTTTCCTGAAACCATGAAGCTGCCAAGTAGCACAGCAGAACAAGCATGGGTATATTGGTACTGCGGCAACGCTACTAAAAG
ACTTCCCCCtcttcggcagcttcgtccatACGACTTGAGCAATCGTAACCAGCGCAAGCGATTGTGCGAGCTGAAGTTTTAATGAAGAAAATCGAGCAGC
GAGCAAGCAGCCTTGGCCTACCGACGACCAGAATATCATTTTcagatgctgctgatgtATTCCAGCAGTGCAAAAGTGCCATTGAGCTGCCGAATGAGAC
GGAAAACAGCAGAaaacgacgccgaggccaacTCGTATGGGTCTCCGCAGCAACTATCTTACGAAAGCAGGCAAAGACAGCTAGTATCACTCAAGTAGGA
TCTTCGAGTGAGAAAAATTGACTGCTTGTAGTGTGTGACTTATCCCGCTTCGATTGAATGCACTATGCAAATTCCTATTCACTGATGTTGTCACACTCCG
AGCTATCAATCGCACAACCAGCTTTTGGGTCGGTAGTCGATACGAATCTATATATCAACTGCTGTCCTGTAAAAACCAACAGCAGTCCGGTAAATTCCGC
CCAAGAGTAAATTAAAAATAGCATCGGGCGAGATCGCcctctcggccagcagccaagcccggccagcagcatcaagcacgaccaacagcaacaagcccAT
GCCGACTGCCGCCGCcccgaccagcagcaacagctgGCCATTGTACAAGATGAGCACTCGACGAGTAAAATATATTGTGCAGACTAAGACAAAGCTCCCT
GTGGAGCTCCAAAGGtgtggcgatggaggagcaggtAGTAACCAATAGCAGCGATTGCGCTCCGAATTCAACAGCTCGATGTCTCCGAGTGACAGCAACC
GCGCAGCGTGTAGATTCTTGAGAGTCCGAAGGGTTTGAGAGGCAGTTGTCTCGAGTGGGGCAAATTCCGTTGTGATTCATTAGTCCTTATCCAACCACCA
CTACTACACGAGGAGGGAAGCCCCAGGCATAAAACCCCTTTGGTCCACCTGCCCTGTGGCAGCAGGTCAATCCCTGCCAATACTGATGTGACTGATAGGC
CTTGACAAGAGCGTGAGTTTCCTGGAGCTAAAGCCGAATGGCTCGTAACCAAAGCGGCGACGAATTCTACGGTCGCGTCAAAAATTATTCGAAGACATTC
CCGTGGCAGTAATATAGCAATACCGGTAGAAGAATCACCTCGAATCGATGCCAAAGCTAAAATAAACAGGTGGTTTGCTTGCCAAATATTGGATAGCAAT
GGCATTACCGCTGCTGACACTCTTATCCAACGCAATCCAGATCGATGCATATCAATTTTAGAGTAATATTGCCCAACAGTGTAGCGTCTACACTGTAGAC
CACGAGATTCCTACATCATATTCGAACTTAGAAAGCGAGTATCGTGGTTCCTGTCACCTGCATCACAAACAAATCCGAGTCAATAAGCAGAAACAAATTC
CATGAGAACTTTGGTCGATGTTGAGCTTTTACACTTGCGGATTTCATACAGCCCGCAGACTGAAGGCTGCACAAATACCTAGTCTTCGGACAGACTAAAA
AAAACTTCACTCACAGATGGCCAAATTGAAGCTGCAAACCACTCCGTCGTTTCATGCTGTCAAGCGGGTCGAAAGAATGGCATCAGGTAAATTCAGCAGC
AAAGATAAGGCCACACCGTGGCCCGGGGCCAACGCAGCCATGAACAACCGGTGACAAGCGTGACAGCAACTCCAGGTCCGTGTCTAGGAGCAAGCCAAAC
TGGACTTGCAAGAAGAAAGCAGTCGCATTTCAAAGGAGCCGTACGAGGTGGGGCAAAGAGCAGTCCATTCAAAAGTTGAGCCAGGCCTCAAGGAGGCATC
TGGAGGGCCGTGCGAAGATCACTCGTGTGTCGGAGCGGCGGCCCAAGGGGTAGCTCTGAGAGGCTACCCCCAGGGGTGGTGGGCGGGTTAAAAGCGAGCG
AGGTCTCGATAGCTATtccgctgctcttctcctcggcgcgAGTCCACTGGTTGCCCCTGATGAGCGGTCGGATAGTCCCGCTGGCCACAAGGCCGTGGCG
CATACGCTGGAGACGCGTGCGCCGACCCCCCGTACGAGCCATACTGATACGGCTGGGAGTACGCGTACGGTTGAGTCTCCCGATAAGGCGCTCGGCCAAA
GACCTGGGCCTGAAAGTCATGGAGTTGATGCCGCAGGTCCTCGACCTCGGAGGTCAGAGCACGGCGATCGATCCGCTCATGGAGATCGTGATTCTCCCGC
TCAAGTA