Description :
From Genome Similarity Track
Location :
contig_166:4149- 7055
Transcript NameFunction/comments
g14520.t1hypothetical protein

Sequence
2906 bases(100 bases per row)
CCGCCCAGAATGTATCCGAACGAATCGGGTCGGATTCTACGCTGAGTATGTTTGGAACTTCCGGAGGATCAAGCGAGTCGATGGCCAGTGCTACATCCAG
TTCACGGACTTCCAGAGATAGTTCGTCCGGATCTTCCGGATGGAGTGTTGGCCAAGGTGCAGGAGTGCATATGCCGTTCTCAGCGTTTGAACCACGGGCA
ATGACAGCTCAGAGTCTGGGAGGAGCCGTCCCGGCGGAGACTGGTGTAGGCATGTACGTCACTCACGAAGTGATTCCACGGAACCCAGTACCAGTGATTC
AGGAAGACATCGTCATGTCAGAAGACGAAGCAAAGGGTTCTCGAAGACAGAAGCCCAAGGTTTCTTCCCGAAGGATCTCCCGATACCGGTCGTACAGCCG
CTCGTTCATACCGCAGTAGTGCTTCCGGAAATGCTGCTGAGACGACACATCAGAAGCCGGATGTGAGAGGCTCTGATGAGATCGTCGCGGCACAATTGCA
AGCTACTTTGCAGGCATTTGCTGCTGACAGAGTTTCGAAGAACCTGATGGGAAAAACCGTGAAGATTTCTGAGCCTATTGTGAACGTGAAAGCGGAACCC
GTTTCTGAAAGTAGAACTTTTGCAATGGGAAAGGCCGAGTTGTCCTCTGGAACCAAGTCAACTGCACCTGGAAAGTCTGTCAAACGGCACATGTCCGAAA
AATCTGGTTCGTCCAAGAAAAGTTCGACTTCCGGAAAGGGGAAGAGGACGAAGTAGTCATCTGGAAAGTCAAGTGATCCTTCGGATTCGGATCCAAGTTC
TGAGTGACTCGTACTCGGACAGTTCAAATAGCAGCTCTTTCGAGGATGTCGTTCCGAATGTCCATACGACATCGGGTCCAGGCGGATCTCTGTTTTACGT
TCAGGCCGTACGTGAATGCCAGCACGTTGGAAGACTTCAATGAGAAGACGTCACTAGCTACCCGTATCCGGTGGTTGGAACGATTCCAGAGTTTTGCCGT
TCAGGGTGGTTGGTCGGATAAGGTCAAGATCTATGAGATGAAGCTGAAGTTACCTGCTGCCGTTCGAAACTGGCGTTCGAACTTGAATCCCAACGTGCGC
CGGAAATGGAAGAAGTTCCTGAAGGAGTTCCGAGATATGTATTGCAAGGCCAAGACCTCGGATTCAGAACGTTATTACACGATGATCCAAAAGAAGGCAG
AAACTCCGCTGGAATTTTACTACCGCCTGAACAAGGTGGCCGACAAAGCGGGGATCGAGTTCGACGCATCGAGTAAGCAACGTGAGCGTCATCTGAAAGT
GTTCACGAAAAAGCTTCTGGACTCTCGCCTCCGAACGACTTTGCAAGGACAACGTCTGCGTCGTCTGAAGGACCTGGAGTATGTCCTGAAACAGCATGAA
GAAATGAATCAAGACGACGACTACGATACTCCACCTCCGAAGAGAGACTTCCGAGCGGACAATGTCCCTCGTGATCGATTCAGACCGAAACGTTCTGGAA
GAGCCTACGTCCTTCATGATGACGATAACCGGGATGGCGAGAGCACGACAGACAAGTCCATTTTTTGGAAGAAGTGGAAGAAGTGACAAGTCGAGATCAT
GCTCCTAGTGTGCTGACTACTCCAACTGCGGATGCCACGAACGTGTCCGGTTCGAGCATGGATAACCTTTCCGAAGCAGTATTTCGTGCGATGGAGAATC
CCGGATGGCGGCCCCCGACTTCTGATTTCCGTTCGGATCGCCGGCGGCAATATTTTGGAAGTCCGAACGCGTCCAAGTTCTGTGACAAGTGCAAGGAGTT
TGGACATCTGACGGAGAACTGTTGGTCGGACATCGAATGGGACATCCGACGCACTTCTGCAGGACTCGTCCGTGTGCGATCTGTAACCAGTTTAACGAAG
GCAAATGTGGAGAGTGGAAGGCTTTCCAAGCGATCAAGAATCTTGCACGTCAAGGAGCACTGAAAGATCTGCCGTCTCCTATCCGGAAGCAACTTCTGGA
AGGGAAGGTGGATCCAGGGGAACAGCCGTTAAACTAGTAAGCCCGCTGGATGGGGATCCAGAACGCGACGGGCTGAAGAAACCGCCCGATATGTGTCTTC
TAGTGTATGTTGGTCCGGAGTTGAGACGCCAAAACCAAGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTCG
TCCTGAACGAGTTCTATCGGAAGGTGTACGGCCGGAATACAAGATCCGGATGTACCTGTTGAATTCCGATTGGGGCCAGGCGAACGATATGGCTGGTGGG
AAGATCACTGTTCGGATGACACGAAACGGATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACAGACATCCTTTTGGATTCTGGAGCGTCAGTAAG
CATGGTGAGTTTGGATCTTGCGCGTAGACTCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTATCTGGACGGTGGCGTTCCGACCATCATCACCGC
GAGTGCTGAAGTGAAAATCACTTTGGGTCCGAGAATTGTGTATGTCTTGGAACTTGGGTCGCGAACATTGGTGAAGGTGTCGACGTGTTGCTTGGAATGA
ATTTCATGTATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATCA
TTACCACAGAGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGTCCAGGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAAT
CCACAACGTGATGTGGTATGGGCTGGTCGGGGAGACCGATGGGTAACCCAGATCATCTATGCTGCTAGATCGTGGGCTGTGGCCATCAAAGTGGTGAATT
TCCGGA