Description :
From Genome Similarity Track
Location :
contig_40:414764- 415864
Transcript NameFunction/comments
g9104.t1POM74336.1 Serine/threonine-protein phosphatase [Phytophthora palmivora var. palmivora

Sequence
1100 bases(100 bases per row)
CCTGACGTACCAGCCGAAGCTCGCGGCGTTGGTGGACGAAACCTCGGGACGCATCAACTACTCCCAGTTTTTGTCACGCTACCGCATCGAGAACGGCACT
ATGGACAACAGTGGGTGGCAAGAAAGTATCATTGCTCTGATCTGCAAGAAGCTCTACCGCGCTATGGGTGCTGGAGATATGCAGCAAGCGTTCAAGGTCT
TTGACGCCGACTCGAGTGGCTTCATTGAGTACGAGGAGTTCCTCAGCACACTGAAAAAGATGGACACGGGGCTCTCAGACCAGCAGGTCTTCGCGCTTAT
GCGCACCGCCGATACGAACGACGACGGGAGAATTGACTTCAATGAGTTCGCTCAACGCTTCGAGGTCATCTTCACGGACCAGGGCAAGAACCGCGAGGGA
GATTCGGCAGTGGAGCCACCTCCGACACCAATGGAGCTGGATACGGAGGCTCCTGCCGAGGGCGAAAGACGGAAACAGAGCACATTTTTGCGCGCCGGGT
GTCTTCAGGGGACGACCAATCGACTTTCACGCCGCAGCCGGCAAGCAACATCGACGTGGAGACCATGCAGGCGCTGTTGCAGGTTGGCAAGGCGCTGTTT
GCCCGCCGCGGCTCGCTGCAGTATCACTTCTTCCACTTCGACAAGAACCAGGATGGTGTCCTGTCACGGAGTGAGTTCGAGCACGCGCTGGAGCAGCTGG
GGTTTGACTTTGAGCCCGATCTGATGGAGCGCGTTATGGCGGCCGTGGACAGCGACGGTGGCCACTCGATCGACTACAAGGAGTTTGTGACGGCCTTCAG
CGTGCAGGACGCGAAGGAGCAGCAAACGCTCGAGTCTGGAGATCTCACATGGCAAAACTCGGTGCTGCAGCAGGTGTCCAACGTGTTCTACCAGCACCGC
ATCCACATTCGCAACGCCTTCCGTATGTTCGACGCAACGAACAGCGGGGCCATTAGCCGCGACAACTTCCGAACTGGCATCCAGGCCTTCAACGTCGTGC
TCAACTCTCCGCTCTCGGACGACCAGATCGAAGAGCTGCTGTCATATCTGGACAGCGACAAGGACGGCGTCATCAGCTACAAGGAGTTCTTCGACGGTTT