Description :
From Genome Similarity Track
Location :
contig_40:414739- 415839
Transcript NameFunction/comments
g8700.t1POM74336.1 Serine/threonine-protein phosphatase [Phytophthora palmivora var. palmivora

Sequence
1100 bases(100 bases per row)
CGTGCTGCAGTTGGATCTGCCTTTCCTGACGTACCAGCCGAAGCTCGCGGCGTTGGTGGACGAAACCTCGGGACGCATCAACTACTCCCAGTTTTTGTCA
CGCTACCGCATCGAGAACGGCACTATGGACAACAGTGGGTGGCAAGAAAGTATCATTGCTCTGATCTGCAAGAAGCTCTACCGCGCTATGGGTGCTGGAG
ATATGCAGCAAGCGTTCAAGGTCTTTGACGCCGACTCGAGTGGCTTCATTGAGTACGAGGAGTTCCTCAGCACACTGAAAAAGATGGACACGGGGCTCTC
AGACCAGCAGGTCTTCGCGCTTATGCGCACGGCCGATACGAACGACGACGGGAGAATTGACTTCAATGAGTTCGCTCAACGCTTCGAGGTCATCTTCACG
GACCAGGGCAAGAACCGCGAGGGAGATTCGGCAGTGGAGCCACCTCCGACACCAATGGAGCTGGATACGGAGGCTCCTGCCGAGGGCGAAAGACGGAAAC
AGAGCACATTTTTGCGCGCCGGGTGTCTTCAGGGGACGACCAATCGACTTTCACGCCGCAGCCGGCAAGCAACATCGACGTGGAGACCATGCAGGCGCTG
TTGCAGGTTGGCAAGGCGCTGTTTGCCCGCCGCGGCTCGCTGCAGTATCACTTCTTCCACTTCGACAAGAACCAGGATGGTGTCCTGTCACGGAATGAGT
TCGAGCACGCGCTGGAGCAGCTGGGGTTTAACTTCGAGCCCGATCTGATGGAGCGCGTTATGGCGGCCGTGGACAGCGACGGTGGCCACTCGATCGACTA
CAAGGAGTTTGTGACGGCCTTCAGCGTGCAGGACGCGAAGGAGCAGCAAACGCTCGAGTCTGGAGATCTCACATGGCAAAACTCGGTGCTGCAGCAGGTG
TCCAACGTGTTCTACCAGCACCGCATCCACATTCGCAACGCCTTCCGTATGTTCGACGCAACGAACAGCGGGGCCATTAGCCGCGACAACTTCCGAACTG
GCATCCAGGCCTTCAACGTCGTGCTCAACTCTCCGCTCTCGGACGACCAGATCGAAGAGCTGCTGTCATATCTGGACAGCGACAAGGACGGCGTCATCAG