Description :
From Genome Similarity Track
Location :
Scaffold_9:414695- 416298
Transcript NameFunction/comments
Phyca_LT1534104444heat shock 70 kDa protein

Sequence
1603 bases(100 bases per row)
ttcgactcgatgcgcagtttgttgcgttcgtcttggtccttgtacttctcggcatcggcaaccatccggtcgatctcgctctgagagagacgtcctttgt
cgttggtgatcgtgattttgttctctttccccgtcgatttctccaccgctgacacgttcaaaatcccattgacgtcaacgtcgaacgtcacgtcaatctg
aggcacgccacgctgcatcggcgggataccgtccagattaaacttgcccagtaggtggttgtcctgcgtcaaggatcgctcgccttcgaacacttggatc
aacacaccggactggttatcggaatacgtcgagaacgactgcgtcttcttggctggaaccgtggtgttgcgtggaatgagtttggtcatgactcctccag
ccgtctccagacccagagacaacggcgcaacgtccagcagtagcaggtcctggagcttggacgacatgttcccactgccactgaggatcgcagcctggac
ggtagcaccgtacgccacggcttcatccgggttgatggacttgaacagttctttgccgttgaaaaactccatcaagagctgctgaaccttggggattcgc
gtcgacccacccaccagaacgacctcgttcacgtggttcttggacagcttcgagtcctgtagaacttgggcaacaggacccatcgtcttgcggaagtatt
cgctgcacagatcttcaaaacgcgcgcgggtaatggtcgaattgaaatcgataccgtcaaataaagaatcgatctcaatgtacgcctgagcggacgtgga
caacgtgcgtttggctcgttcgcacgccgtccggagtcgacggagagcgcgttggttcccagtcatgtccttgcgatatttgcgcttaaactccaagacg
aagaactcgacaaggcggttgtcaaagtcctcaccgcccagatgcgtgtcgcccgccgtggctttcacctcgaagatcccgtcttcaatggtgagtagcg
agacgtcaaacgttccaccgccaagatcaaagatcaacacattgtgctcgccccctttcttgtcaaggccataggcgatagcagcagccgtcggttcgtt
gatgatacgcagcacgttcaaaccggcgatgactccggcgtccttggtcgcttgacgctgcgagtcgttgaagtaagctgggaccgtcaccacggcgttc
ttcacctgtttaccaatgaaagcttccgccacttctcgcatcttaactaacaccatggacgagatctcttccggctggaacgttctcttctcccctttaa
actgcacctccactagtggtttgctctctggaccacggactaatttgaacggccagtgcttaatgtccgactgcacttccgggtcggtgaacttcctccc
gatcaatcgcttgacatcaaacactgtgttgtgtgcgttcatggccacttggttcttagcggcatcaccgataaggcgctccgtatcggtgaaggccaca
tacgacggcgtggtgcgattgccctggtcgttggcaatgatctccactcggtcattctgccacacgccaacacacgaataggtcgtgcccagatcaatgc
caa