Description :
From Genome Similarity Track
Location :
Scaffold_144:41464- 59985
Transcript NameFunction/comments
Phypl_g4120conserved hypothetical protein
Phypl_g4121conserved hypothetical protein
Phypl_g4122hypothetical protein PHYSODRAFT_358438
Phypl_g4123conserved hypothetical protein
Phypl_g4124hypothetical protein PHYSODRAFT_309159
Phypl_g4125conserved hypothetical protein
Phypl_g4126hypothetical protein
Phypl_g4127serine protease family S10, putative

Sequence
18521 bases(100 bases per row)
GATCTGCCAGCAGTAATGCGGTGGACAAGGCGGCGCTTCAACGGAGACCTGCGACACCAATGGTATCACAGGACATCCCCTTGGCCCAGTCGAATTGGGA
ACACCACCGTCGACACGTGAAGCAAAGCGCTGAGTAGAGACCTAAAGTACTTGCAGTCCCCGGCTGGGCTCGGCCAGATGCCGGCCCATTGACAGGTTGG
CATTAACTGACTGACAGTCACTGGTGTCAACCTCGGGCAAGTACAGCTTATGGATAAGCCACCAAAAATTCCTCATGAGCTTCGACGAAGTGGCCAGCGA
CTGATATGTGTATCGGCAAAAAATGGTTGCCGTGGATGGGCTCCGCTCCAGGATCGCCTGAAATGACGCCGAAAAAGAAACTTATCTTATCCGCTGGAAA
TTCGATGTTGAACTCGAACGGTAGAACCCCTTCAAccgcgccgccgcgatggACGCGGCCAAAGTACCCGACCGACTCCGCCGCCACTTGCGCTGAAGTA
ATACGTGAGGCGCATGCATGAACCCTGGGGCTACTGCTATTGCCGAGCCGGGCTGGGAGAGACGACCAACTGCTGTAGGGCTCTGCCATTTGGTAGGGCT
GGCGGCTCGGATTTGCAGGCCAGCGCGGGGTTAACAGCGCCCTTGAGCGCGATTGTAGCTAATGCTTCAGGCCAGATTTGGACTCGGCATGCTACATCGG
AGCAGCGCAAAGGGGAAAGCGCGCCACGACGAACTTTAGTGGTCGACGATCTCAGCGTGGGCTGGCCGGCCCCTCCTCTCCCCCCGCCaccgtcgagctg
cttccaTTCTCCAACTCGCTCTCGACCCACGCGGAATCGGCTTCCGGGCATTTCGTTTCCCCCGCCCACACCAGAAGTTTCGTCGCTCGCTCAGGAGGGC
AACGGGAGTGCGAaggagctgccgtcgtcaccaactgcaagcagcaacgaccTGCTCCGTCTCTCACCAGCGAGGGCTCTCGGCAACTCCAGGCCGCTTC
GCTGGTACAATCCCAACCCGCTCGGTTTCACCTCAGCCTCACTCGCCAATTGGCCTGCCAAGGGCCGCACCGCCAAAGCGCCGCGCGCTACTTACATCAA
GTGCGATCCGCCACGCTGCACGCCACGCTGCAACACGCCAACCACCGGCAGTGAATAGTTTTTTTTATACAGAACGGAGCCCCAGCCAGATCAGCCCCGA
CCGCGCCCGCACGATGCCACTTTCCATCTCGTTTTACCACAGCAAACGCGGCGAGGGCGTGGCCAGCTCGTACCAgagcgtggcgctgcacgaccgAGAG
AAAGTGAAGCACAAGATGGCGCTGCCCTGCGAGTTCTACCGCAACATTTGGGGCCCCtccgaggagcaggacgcggcgctgcggcggcgcgcccGGCCCA
GCAagttcagcagctctccgGCCTCGGCAACGTCGCGGAAAttcaagaagcgcgtggcAACGGGCCCCCTCGTTGACATCGCGCAAGTGGCGCACGTGGT
CACGACCATGTCGGACTTCCGCGCCGACTACGGCGAAGACTCGAAGAAGGTGAGGCGCGTCAACATTTGGGACGATCGAAGCCTCGCGCTGGGCTTAGAA
CCAGAGTCCCGGTCGGGCAACTCGTCGGAAAGCAGCGCAGGCAGTGAGCAGGGCCCTTCCACTGCAGACACTGAGCCGGAGGAGATCATGTCGCCCATTT
GCAGCAGAGCGGACAGGATCACGGAACTCAGCTgcgaagacagcgacgacgacctcagCAGCTTAGCGTCTTCGGTGATGAACCGGCATCGACCGGGGGA
GCTGAAGCGGGCCAAAACGCCTGAGGTTATTTTCCCAAGCACTAAGAAGAACGGCAATGGCAGCGGCAGGGGCAAGCCGGACAGGAAGGCGCTCAACTTT
AAGAACTTGCCGGTTCCCCCTCCGTCGTCGCACAATGGTAGCATCATTTTCAGCGCCGTGTTCTCGGAGCAGCGGGACTGGAGTTGGAGCACCAAGTTCC
TCTTGGGAGTCCATGAGCCCATTCGCCACGCGCTTTTCGTCATGGATCGGTTCTTGGAGCAGTCTCAGAGTCAGTCCAAACCTGAATCTTCGCTCACGTT
GGCTCTGGAGGCCCATGTGGCAGAATTCTTTCTCTGGTTCAAGTCGTACTTCGTGGAGTATTTGCTGTGCCAACATGAAGTAAAGGCatccgtgctgctg
ccaatgctCAACTTGCCAGTGTCGACAAAGCAGCAAATTCTAGATGCGTACCAGGATATCAAGCAAATGCTGACACAaatccagcagctggagcgtgCGT
TGTGTGTCAGCGGTGCCTGTAGCGCCTCGTCGTGGTTGCTGCGACTTCAGGTGCTTCAGACCGAGATCAGACAACTCAACCGTACACTGCACGCGGCGTT
GAACATGGAGGAGACAACCTTGCACGCAGCAATGAGTGCTGCATTTACCGAGCGCGCCTTCCGAAGCCACATCATGCCTCGCGTATTCCGCGCCATCCGA
GCCAAACGAGTTGTAGTGCCGTGGATTgtggagcgcagcaagaTCTGGGGAGGAGAAAcggagcagcgcagcatccaTAGTATGCTGCCCTTCTCGGCGA
AGTTCATGTACCGCAAGGTTTGGCGACCATACTTCATGAGTAATGTGGCAGTGGCGATGAAGAACCTGAACGAGTTTGTCAGCTCTGCCGACTCGAACAG
CAGTGCCAGTTGCGGGTCGACGTACAGCGAACGCCACGGCGAGATGTGCTCCATCATGTGAAGTGGCAGTCTTTCGTCCTCTCTTTCTGGAAGCTCTACA
GCTATTTATTATGGACCAACATCAACTATCTCAAGCGTGTGTCGTAGCGTGACCTGGGTTAGCAGAGCTAAAAGCCGAAGCAGCGCGTAGAAGCAGCTTA
CTCATCAGAATCAATGAAAATGCTTTCTAAATCATTCAACCAACGCTTTTGGCTTTCCCATTCATCGAAAGCGCCAGCAACGGAAGTTGAACGACTTTTG
TGAGTTGTCGCCCAAGCACCATCGCATCAAACGCGAGTGTCAACGGTTGAATTCAAACGACGTTGAAGTTATAGGCCTATCCAAACGCGTGCCTGTTATC
CGTCGTTGGTTTCATGATCGTTAGCGTCGGCTTAAAACTTCCACTGCGAAGGCACCTTGGGGGAACTCACTAACCAAAAGAGCAGAAGTACCAGCATGAC
GGCGAACGAGAGAGTTCAAGCAAAGAACGAGACGAACTTAGTACCAGAGCAACAAGAGATGCACGACAAATCGAACGACAATGCCAaagacagcaacaac
tcggCATCTGACAAAGATTCTCAAGCACCCTCTATCTATTCGAAAGTGCCTCGAATTGCATGGGACTGGATATGTTGGTCTGGAGCCAAATCGTTCGACA
GCATGGATTTCGCgggcgaggtgctggcgaaCTTTCTAGGGTTGACTCAGTCGAAGTATCAATGGGTTGTCGACGCTCAAGAGcgtgaagaggaggagaa
gcagcagcggcggctcgaaaagcgccagcgccgtcagcttcgtctggagcagcttctcgaggcAGAGCAGCGTAAACTTCAGGAACTAGAAACCGGTGCT
CTTGAACAGGACTTTGCGTTAATAGACACATCCACCACAGTGTAGCCGCACTTTGGTGGTAAGTTCATTTTTGTTTGTGTAAAGGTTTAGTTTCCTCTGT
TTGGTGCACCACCATTTCGGCGATGCCTTGCAAAGACCAAGTGCATCGAGACTTATGGCAACTACTTACAAGTAGTGATCAGGATCAATTGGCTTTCACC
TGCTCTTGTCTATACttgctcgccgtccttgtcctcgatGCTAGCCCATAGTGGATGTGGTGGTGGCTTCACTCCCGCGCGCACCAGCATTCGCACAGCT
GCCTCTTCGATGCGTTGCAGCTGTCGATTCACAACACTCTCACTCTCAGGTGTAAATTGCTCCGTCCGAATAGTAAGAAGTCCTTCATGACAGCACAACA
AAGAGTCACAACCTCGTCGATCGCCAGTGTCTCAAAACACAGCATCTCACCATTAAGGTTGCCAAAGAGCACGTCTGTCGAGTACCGATCGCCAATCATC
ACAAGTGCGTGTGGGTCTTCGTCACCAAAGTGCTTCTTCACGAACGCAATGCCTCCAGGTTTCTGCATGACAAGCATATCAATCTCAATCCTTCTAGCCC
AACAATCCATACAAAAACAACTCTCGATTACTTAAGTAATACCTTTTGGTTGTGACGCAGCACCGCGACatgcagctcctcctcgatcttccTGGCCTCC
ACtccgtccttgtcgtccgtTGACCCAGCCGAgttggagaagatgacgacgcccGAGTCCCCGAAAACTCGACGGCATTCCGCCAGTGAGGACTCGAGAT
TAGGTGCAATCTCCAGTTTATGCGGCACGGTTAACGTGTTGTCCTTGTCGAAGATAACTCCGCGAAACCCGCGGTCTCGCAGCGTCTGGAAGGGCACCTC
TGTCACATCTGAAGCCGCCGAAATGCACGAATAGGATCAGTTTTCACATCAGTATTTTGCCATGCAAACGAGTCGAAGGATACCCATTATCGCACGCATT
GCAAGAAGAGATGACATATATTACCTTTCACGGAGAGCTGCGGTAGCAGAAGCTGCGGTTGGCGCGTCAGCACGCGGCAGAACTCCACCACGCCGCCGAG
GTTGAGGCCTTTCATGGTCCCTGTCGAACCAATCCCATCACTCAACCATTCGTCAATATTCTACTTCCTTTTCTACCAATCACCAGTCAAAGCCGTTTCG
ACAGCCAGTGAGCTCGTCAGAAATATTCGCTCTCCGTCACCCTCAagacgccggcgctggcATCGCTCCCCGCGACACGGCcccgcagcgtctccttTCG
CCGCACTAACACTCGAGGGTCCTCGCCCTGCATCTCCTCTCGCTGCACCAACTTTTTCCAGCTTCTAACGCCCCATAATGGCCGAGAACCCGCAGCAAAC
GCACGTcaatgaggaggaggaggacaaggccgagaactcgagctccgacgacgactcgtcctcctccagctcgggctcctcgtcttcctcatcgtcgtct
gATTCCGAGTCGGAAGATGAGGCGGAGGCTGAGAACGCCGACGCCAAACAAGGCGCTCCACACGGAGCCACCGGCAGCCGCACGGGCCAAAGCAACCCCA
GCGGCACCTCGGGACCGGCCCTGTCTGCGCCTCGTCCCCATGGAATGGCGGCCAATACCGAGACGCTGAACGTCAACTCGACGCGAGCAGTGGCCAGATT
TAAAGCtgcggagacggaggcgaTGATGCCCCTGGGCACGCGCAAGCGAGACCGACGCAccatcgaggagatccaAAGAGATCTAAGGGACAAGAGGAAG
AAACCGTTGGGCACTCCAGCGGCGAGATCCAGTCCCCCGCCTCCGAAAGGTTCGCCAGTGCGATCTCCGGAGGCTGAAGCGGTGATGAACAGTGGAGCAC
CGATGGCTGTGGGCGGTCCGCTGGGCTCGTTTGGAACTGCAGGTCGGCTGCCAATTAAGAGGAAACCCGTGTCGGCACATGACAGGTTGGCGATGAAACT
CAACGGACGAAGGACGACAAGtgccaagaccaagaagacggccAGCTTGACCGCTGGGAACACCACGATTCCGCCAGTGTCGGTGATGACGAATAAAACG
GTGACGAAACCCATGACTGCCACAAGTTCGATGGGCACAGCCACaggaaacagcagcagtagtgACCATGGAGGGGACACTGGAGCTGACGGATACAGta
gcagcgtcagcaggtcTTCAGCACCCGCTGTGGATGGCAAGGTGGTGCGTGCGATGCTGCGAGCTATGCTTCGCTATGGAGACCTGACTGATGTCGGCCT
TTATCCGACAGCTGCAAATTTCGCCGACGAGTACAAGATGCCCAGCTTTATTGAGCGATCGAATCTGCCAACAACGACCAAGGTCCCCATCGACCATCTC
CACACGCTGGCCAATGAAGTTGCTCAGAAGGCCAAGCAAGCGGTTGAGGCACGGCCACCGCATGACAACATTAAGATCGCCGAGGTTGAGGCAAGATCGA
CGCAGATTATTGAGCGTCTGTTTGAAAACCTAAAACTCCGTGTCGCTGTCCAGCGTGCCTTGCGTACAGCGGGATGCTCTTCAGGCAACGCGCAAGTGAA
TGCTCAAGGCGCATATGTATTAGTGGCGAAACAGAGCGATCTTTCTGTTCTGGGTGTGAACACTCGAGACCTGCCTAACTGGACGTGGGCTGAAAAGGAG
CATGACTGGACACAACGCAAGgatgcagcgctgcttctcggcgtTTACGTCCACGGATTTGGAGGTTGGGAAGATATTCTCAATGATGATTTACTTCATT
TCCAGGGACAACGAGCTTTGAAGGGCGAACGCCTGAAGAAGCGTGCTGAGAACCTGCTTAAGCGGTTGCCCGCTCCTGTTCTTGACGCTGGCGACCCGCG
CATTGTGCAGCAAGCGAGCTCCCTGAGCTCCGCGGGTGCTAACTCGAACCAATCGTTAGGTGCACAGTTTAGTGCTATTATCCACAGTGGGGCCATCCCT
GGCGTGACAGCATCCATTCCTGCCAATTCAGGTACAGGAGGGGGTCGGAtggctcgtgctgcagaacgatTCGCTGCACGGCAACAGAATGGCGACGATG
TTGTGGGGCGACGTCACACTGGATCCAGCAACGGTACGGGGACGTCTAATGGTCAGGGACTGGAATCTGGCCGACAGAACAGGACACCGCTAATGAGGTC
CCCAGCGCAATCTAGTGTGGTGGAtaacgaagctgaagaaggcgaaaTCGGCGGTGCATCACCCGCTCAATCAACGTCGTCACGGCACAAGAAGCGATCG
TCATCAGTGGAGGATGAAGATCGGACGTCATCCCGTAAAAAACACCGCAGTGAAAGCTCGACCAAGAAGGAAAAGCGGAAGAAGGAGCACCGGCGGAGCG
AGCGAAGTGAGACGAAGACCAGCGATACCCCAGCGGTGGTGGTCAATGCAGTTGCAGAGGTGGCACCGTTACCACTGCTCTCAGCTGATGAGTACTACGA
AAAGTGGAAACCAGACAAGAAGTTGCGCGAGATCCGCCAAGAGCTCAAAAAGTTGAAGATTATGGCCAAATGGTCCCGCAACCAAAAGGACGAGACTGTC
GTTGAGAAGGTGTTCAAGTATGTGAGTACAATTGGTGACGCGATCGATTGCGTTGTAACGCAGCACCAGGACAAGGCCGAGCGCCACCATTCGGACGCGT
CAGCTCGCGAAGTTGACGAACTCTGTACGTGCCTATGGACATATGCCGCGGGTTTCACTCCTTTCACGCCACAGGGCTTCGAGCGTCTCTACGACGACAT
TTGCGCAGATGGAGACGCTCTCGTCTCGACTAAATCATGACGCTCCACAGAGATTATCGCTAGATAAGTGTGATGCCAAAAGGCAATCCAGCCAGGTGCA
TGTACAGAGAacaagggggggggggggggagaTAAACGTATCAACAAGAACTGCATCCAGATTGTGACGACAGAATgtacatgcagcagcacttgcaaaT
TTGGTTTGCTTGAATGAAACGGTCGCAGCAAGAGGGTCGCTGCTGGGGAGGACCGTTTGCATTTGAGTAGTTGCAATTCGGGGGCACTGCAGTGAACTGA
CCAATGTTATCCGTGttgcagccgccgcccacggcggaggagctggcactAAAGGAACAGATTACACAGATGCTGACAAGTCAaggcgtgctggccaagc
tgaaggCAGAGCTTCGCGCCGCTGTCTTTGAGGTTATGCATGAACGCGAAGGTTTCGTGAAAACAAATGACCCCATGGCCCCGAAGCTGAGTGACTTCCC
GATGGAGACCAGGACAACCGCCATGTCGATGATTATTGAGTGTCTGCGGTTTTTCCATTGGGAACATGCATTGCGTGTGCTACTTGCAGAGACCAACGAG
GAAAATGAGCAACATGATACTGCACTGCTGGCTAAGAAGCTTGGTTTAGCAGGCAGCGGTTCCTCAAACAAGCCAGCACTCTTCCAGCTCATCGAGTCCA
AGGTGGGCCATGGAGATCAGAGTGCAGCGTCTGCTAGCACATTGACATCTGCGAAGTACGATCACTTTGATGACGAAGCTGACAACGAAGACAAAGTAAG
TCCGCCGGACGATATATCTGCCCCAACAGCGAAACCATGGGAGCAAGACGAGGTTGTGGGACAATTGTCCTCGAAAGAGACCGAACAGGAAACCAGGCAT
GATGCAAaggatggagaaggtgagAGCAGCGCAGAGATCGAAGAGAGCATGGCAGAAGAGGTGCCGAGTGGATCCGAACTGGAGGAATCAAACCTTACAA
ACTACGATAACGAGGAAAGCCAAGATCAAAGTGCTGTAGCCAGCAAGCAACCCACCACCCTATGCTCGAGACAACtgcatgaagaagctgaagacgacga
taAAGCTCTGCAAGATAGCTGTGTACAGGATAAGCACGAaagcgatgacgaagacgcagtgTCAttggcagcgccacctccagcgccggcaaAGCTACCA
TCTTTACCACCGTTGGGTGGCGCACCAAAGAATACTAtcgctggagatgctgagGACGACTTTGATGCGGTAAGCTCTCTCATAGAAGCGGGCCATGATT
TTTGTGTGTCTTAACATGCTTTTGCTTGGTAtaggaggaggaggccgagcgGTTAAGGAAGTTGGATGCTGCGTTGCAAGCCATGGAGGCCGAGGATGAT
ACAGGCACACTACAGCAGCTGAAAGCATCTTTGCAAATGGAATTGCAAGAGCAAGATAGTTTCGTGAGCAGTGGCGTGCTTGCCAAAGCGAAAgaggacg
atgatgatgacgaggaaTCTGACGCTGAAGCGAGTAAACCtggcaaggacgacgaggaagatgacAATGGGTACGGgagcagcgacttcgaggaggaagg
agaaaTTGCCAGGTACGACATCTGCACAAGTAATTTGCTTGCTCTTGATGATTGTATTGACAGGAATCTGTCGGTGCTATTTCAACAGTGACATTTCCGA
GGAAATGGAGTCCATGCCAGAACTTTcggacaaggaggacgaAAGTAACGAcggagcagcaacgtcagcagcagaagtGGAGCCACCTCGCGTGCTCCGA
AACGACACGCGGGTTGACAGCGAAGATGCGTTGAACAGCTACGACTACATCGAAGACGTTGAGAAGGGTGTGAAACGTCCAACGCTGCACGCATGAAAGT
ACACGAAAGTACTGAGCCTATCCCCTTAGATCATCTTCACCAGTGCGGCTAAACTGGTTTTGAATCTGCACGAAAGTACTTTCGTGCACTTTCATGCGTT
GCACGAAACAGCCCTATTTCACAGGGCTCAACTCGTAAGCGCGGATGAACCACAAACCAAAGCGAAGAAGCAACTGTGAACAAGTCACTGTTTATCAACA
AACTATATTCTAGCGGTCGATTATCGAATCAAATCGCGAGTTGGATGGCCTTATTTGCGTTTTCCTGCTCCGACAAGCTTGTTCAGCAGGGTCCGGTCTT
CAAAAGCCTCCGGGTGGATGAAGTAGTGGCGGCCACGTGCCTGGAACGAGACCATGGGGTGCATCGACTCAGTAGGTGGCGACACGTCGGACAGTCGGAA
TAagtgcttctccagctgagcGAACAGCGTCAACGTCTCGACCGTCACGGTCGGGTCACCATTCAAATCCGCGCCAACAGCAGAGGGCGCCGGGGAATCG
TCAGTGGAAGCGTCCGCCAGCCACATCCGCATCACGTACGGCTTGAACAGGTAGTGGAACAGCGACGTCGTGCCCAAGCCGAACAACATGATGGTGCCGC
ACATTGCCCACTACAAGATGCAAATCAACAACACAAACACCAACACTGCGTCAGCGTCCCCAGCACTCCTTGCAAATAACCTATAGCCCCTTCCAAGAAA
CTCTGCATGGGTTGCCGACCTTGCCGACCGTGGACGTGTCCTGCTCGCTGAGCATACAGAGCACGGGCATGCCGGCGGACGTGAGGGTGCAGCTGGTTAC
GGACACAGCCTTCATCAGGCGCACAGCGCGCGACATGGGCGCCCGGTACACCTGGTCTCCGGCCAGAGCACtgtcgctctgcagcagcctctcCGTCTCC
TCATCTCTCGCCTTATGGGCCTCATCATCGGACTGGGACGAGCTGAAGTGACGAACGTGGAACGGGTCATTGAACCCagagctgcggcggctgctgaaGT
CGAACGAGAACCgttgcagcgcagcagcactgccagGGCGATTGACGAAGCGGGAGGTCGTGCAAAGCGAGCGAAACGAGGTCGGAAGCGCCTCCGCGAG
TCGCACTGCACGGCGCGAGGTTCGCAGCACCAACATGCTTACGGGCCGTGGCGATCTGTGGCCAACACGCACAGACACAAACCGAATTACCGGTTAAAAG
CAGTATCGCACCTAATCGAATATGCGAGGCGTACGACAATAGACTGTCGAGTACCGTGGAGGACACCCGCGGACCAGCCGCGTAGAAGCAATCggtcctg
ctgcgccgcgcgACCTGATGCGTCCACCTGCGGCAGCGGAGGATTTATGGAGTTGAATTTGCCGTCCCCAGTGCCGtttcgtggtggtgcgctGAAGCAT
GGCGCTGAGGGCACTGACGCATATGCTGTCCATGTTTGCCTGCCAGCAACACTGTACTGTACTACAGTAGAACGATGTGAGACTTTCGTCAAGCTTGTCG
TGCCTTTAGGTACATGTTCGTTTGATGATATACAATACAGTACAGACCCCGCTTAGGCTATCACTCCGGATCAGCGCCGGGTGCCGGACGCTAGGTGCTG
TTGTTGAAGTTTACTTGAGCGGGGTCGAGGCTTGACGCATACCGCCGTTTTCTGCGCTCGCCCACTCCAGATGGCTCGTTGCTGGCGCGCGTTatgtggc
agcagccgctgtTTACGAAAGGCACAGGTCGCACGACGCAAACCAGATGGATGCCATCGCGTAAACCGATACCGTCATGGCCGAACGGGGTGGCATGCCC
ACGCCCTTTTCGGCAAACCGACAGCCTGCCGCCGCGACACCAAGTCAGCACGGGCACTCGCAGACCATCGCATCGCTTCCCTCAGAAACCCACCCACGCT
CGGGAGACAGGTCACAGTGGCACCCGCTTGCCGCCACCGATCGGACGGCTTCCGGGCCGACCCCCCTCGCTTCGATATTTTTTTCGCGGCGAATGTATCG
GCAATGGCGAGGTCTGCCAACTTTGGCTCACTTTGGCTGGGCGTTAATTGAGCGCCGTGTACCCCGCGCGCGCGGCAAACACTAGCAGTTTGCGGTGCTG
TCTTGAGATCCGGCAGACCGCGCTCGCTGCATTTGGACCTCATTTCACTTCCGCcatggcggtggtgcagcttctttTCGCCTTGGCGTTCCATGGTATA
ACTACGAACGCTTTCCCTCGTGCGGTTTTTGTCCAATTGCCGGCGGTCGCCAGCGTGAGTGGCGAGAACGATACCCAACGCAAGATAAACACTTGAGCCC
AGCCGCCCAAAGTCCCCAACCCACACGCCTCACTCCGCCGCGCGCAGTGAAATCCACCCACTCGCCCTCTCGTCCAGTCGCAGACTCGTCACGTTCGCGC
TGGCGTTGCTCGCTCGCGGCTCGCTCGGTCCCTTCAGAGACCGGAGGCCACCTCCCTACAGCGCCGATAGCcacaagatgcagcagcgacgacagaCCGA
GAGCGCAGACGGCGGTGGGGCTCCCCGACGCTCGCTCACGAGTCCATTCGCAACCCAGACAGGGGCCCCCTACcagccacagcaacagcatcagccactg
cagccgcagacgacgagcttTCTGCAGTATCCGATCCCGATGGAGCCTTCTGCTCGAAGcttcaaccagcagcagcagccgatgcagatgccgccgccgg
gACGCTACTGGCAGGCGCCAGTTGGGATGGACACTTCAAGTTACGCGAAGCAGGGACGCCAAGGCGGCAGCCTGGACTTGACTGAGTTCGGAGGCATTAT
AGACACCGAGTCCGCCTCAGGCGGCCACGATGGAGCTACAGCTGGAGGGGCACCGTCTGATGCAGCGTCCGACATGAGCATGACCAGCTTCGATGTGAAC
TCGTTCCACGACGGCATGACGGGGTCGGCTGGAGCCTCGCTGGGGGACTCGGGTGGGTTCCACCCGACTATAGCGACGGCTTCGATGCCTTCAAGGCCAC
CAGCTACGGCGGCAGAGCCGACGCAGGCTCATTTTGCGACGAGCAGTAACCCAACGGCGGCTATTCCACCTTCTTCTGATCCAGCCACCAGAGCTCTGGT
AGACGCCGCGTACACGCAATTCGGCGAGTCCCCCAACGAACCCGACTTGAGGACAGAAAAACTATCCAAAGACAGGAGCGAGAAGTGCCAATTCCACGAC
TGTCCGAACCGAGCACGGGTGTCTCAGTACTACGGCAAGTTCTGCAACCGGCACGTGATCGTCGCGCCCTGTGGCTTTCCTGGTTGTCGGGAAAAAGCTA
TGGAGCGAGCTGCCATGTGCGTCAAGCACATGGAGCAGGGCAAGGAGGCACTGCAAGAAATCTTGGATACACGCTCCCAAAATGTTCCGGTGTGTAAAAT
GTCCGGGTGCTTCAAAAACGACCAAGGCCGCGGATACTGCCGTGGCCACGAGAAGTTATTGATGGCTACCGGATGCCTGCCATCGCACATCAATAAGCGC
CGCCTCAACAGTGCGTACACCATGTGCAGCTATCCGGAGTGTAACAAGCATTCTCAGCGGCATCACTTATGCCGAACCCACGGAAACCTTGTCATAAAGC
AAGCCCAGGAGCTGGCAGATCGACCTGGAGCCACGGAAAGCTACGAAGAGATTTTAGGCAGGATGCAGAAGGAAATACGTCGCTGCACTCACGAAAATTG
TACGAAAAACTCGCAGCGAGATCGACTGTGCACGACACACTATTACGAAAAGCACCATCTACAAAAAGATGGCCTGGCTCCGGCAACTTCTGCCTCGGCA
TCCAAAGAAAAACTCGATTCAAGTCAAGCAAGAGTGGGGAGCAGTGGTGGGAACGATGTTCGAGATGTCGAGCGGACTCGCTGCGGGAAACGGGGTTGTG
GAAATCTGTCGTATTCTGCAGGATTGTGTGTGGAGCATACGAAAGAAAACCAAAATCTGGCCCTAAATGAAGGACGTTACGGAGATCCTTTCTCGTCTGG
AGAGAGTAGTGGCCTCTTTTCGGGTGACGTTGATAGTGAAGAAAAATCGGGATTGTTCATCTTGGGCGAAAAACCGCAAGGCACTGGTGCCCTCCTTCCA
GCCAGCGTCACATCGGTCACAAACATTACCCACACGAAGTGCACAAATCCTATGTGCGATCGAGAGAGTTTTGGCCGGGATTACTGTGCGGCGTGTCAAA
GACTTTTTTCGCCGCTTGTGGTATCGATAAATTCCAGTGCATCTGGATATCCACTGAATGCTACGGGTGCTAGTGTCGTTCAACCTGAAGAAAAGATTTT
ATTGTGTCGTGTGAGGAATTGCGGGCAAGACTCTGTCGGTGGTGGACTATGTGCAACGCATCTTCGGGCTTTCAGAACCGGATCGCTATCTGTGGATAAT
TTGAAACTGGACTCGCAAgcgcaacaacagcagcatggaCAGGAACTGGCGCAAAcggcagcagtcgctgctgcagtggttagtccaccagcgtcggGAA
AGGCAAGAAAATATTACTGCAAAGTTGAAGGGTGCGAGAAGCAAGCGCAGAAGCGAAACTTGTGCAAGCGTCACTATCGCCAGCAAGAGGGAGTTCCTGC
CGGTAAATCGCATCCAGAAACTTCATCGAGTGGGTCGCTGAGTAACTACGCGCCTGGAGTGCCGCAGTCCGGATTTGCTCAGCCAACGGCTCCAGGGTGC
CAATTTCCAAGTTGCTCGCAACTCGCTTGCGGCAGTCCTCTGTTGTGCTTGTCACACTGCAACACAACATTTTGCTGGCAACCTGGATGCGAAAACCTTG
TGGACCACCAGCAGTTCTGTGAGTTTCACGCTTTCCGTCAGCAATGCGCTTATGAAGGTTGCATGTACAGTGCTGAGCGGAATggcagcggctgcgcgaA
CCACGCGATGGCACGAAGGTGTCGCCATGAGTTTTGCGATAAGTTTGCTGTGGGCTCGGACAGCGACTGGTGCCGGTTGCATCAGATAAGTTGCCGAGAC
GCTCCTTGTGTGCTGTGCAAGTTGCACGCACTATCTATGGATGGGTTTGCGTCAAGTGAGAACGAGAATAGCAACCGGGGTCGATATAACGCCTCGACAT
CGGAGGAGATGATGCCTCAGGGGAGTTACGGCGGTGGCAACCCATTTGCCCGGAATCCACGGTTGATGTAGACCCGTAGACATCTCAGCGCTTGGAAATG
CATAGTACAGGAGGGGGGGGGATGGAGCAAATAGTCGTTCGTCGGTTTTTCATGTGTAGGTAGGATCAGAAGTAGGAAttgaagtcgaagctggcgaaga
aaGTAGGAGACAGTTATTATAATTAAGCTCTCGTTATGTGTACTTGAGTCACGGCAACTGAGATGAAGCCATGATCACCtcaccgtcttcgtcggtTTTG
CTTGTACGGGTACACGATGAAGAAGTCTCGTCAATCTATTTCTCCGTCGAGATTTGCACCAAAGTGCTCCTCATGCCATGAGTCATATTTGCAAACATAC
CGGTATCCTCAGTATCGAACCGGTATTGTCTTCACGTCGGGTCGCCCCGACGTGACTTCCGAGCTTCAACGCAGCTAGTCGTCGCCCCCCGTGAGCCAGG
AAGCGATCATCGAGCGCTCCCCAGACGCGTAGCCTAGCCGACCGCCGCGGCGATGGAGCGCATCTACTCGGCCTTTTTCACGTCGGAGAGGCGCcgcgag
ccgctggagctcaccGCCGCGGCACTGGAGCTTCACAACGAGACGCAGAAGTCTCAGCGACAGCCGCCGCTCTTGCACCCGGGATGCGACGGCGGAGGGC
GGCGGCCCGATAGAGAGGAGGAATCTCTCAATGAAGCCAAGCGACACGCGACTGCGAGacgccaggagctgcgcaagatgGCGATGGACTGGGCCAGCGT
CAAGAAAGATCTGACGGCGGCGTGTCAGGCCGCGGCCAGGGCGTTCGTACTCGCCTACGGCGCCAAAGCCTTCACTGCTGTGTTGCTGGCCTCGAGGAAG
TGGAGCAGTCTGGAGTACGGCTATGCTGATGCGGCCAGGCTACTTCTGAAGGGAGATACGCTCCGCttcggcgccttcttcgggAGCTTGGTGGGGGTCT
TTCGGGTCACGGAACTCGTGGcaagagcagctcgaggtggAGAAAGGGATGCCATCAATTTGGCCATTGCAGGGGCAGTTTCCgggccagcgctgctgct
ggactcgccCTCGAGACGCAACACCATCTCGCTGTACATTTTTGTACGCATGCTGGATGTGGTGTGCCGTCATTTGATGTCGATTGGCGTCTTGCCGACG
TGGCGCTACTCGTCGGAGATGCTCTTTGCGTTGAGCAATGCTGCTATCATGTATGGATTTGTTGTGGATCCGAGTCTGCTGCCGaaggtacatgtacatt
gAGCtgatggctgctgctgcttttgaAGTTTCTGGAAGGTGTCATTTGACTGGCTTCACTGCTTTTGTTTTCATGAATTTTGTGTCGTCTAGGGTTACTA
CCTGTGGATTTGTCGAATCGGTGCCGTGAACCACCACGGCCTGGAATACACTTTGCGTCAGCGCATGCGTGGCCAGCTTGACGCGCATGGGAACCCGTTG
CCATTTCGTCTGTGCCAACCACACTACCACATGTACGCACACAAAGCTTATGAAGTTGATGCTGAGGTTGTCACTGATTCTGTATCAAATGCTTGATTAG
GGAGTCGTGCGTGACTCACGCCATCAAGGAATGGGTCAACGGCTTGGGGCGCTCCATGCAAATCTACCTGCCTGTTCACTTCCTCCCCGCGATGTTTttc
cgcttccagcagcttcagggAGCGCCGGTATCAACAACTGCACGGATCTCCTATGCAGCCCTTTGCTCTTCAGCCTTTCTCACGTCGTATCAGGTTCGTG
GTAGTGCGCCTACCGGTAGTTAGCAGGTGACGTGGAACTGCCCCGACAAGCTATTAACTATTGCGCTCTTGTTGTTCAGACGGTGGTAAAGCTTGTCATT
TGTACGGCTCGCAACGCATTCCACCAAGACTTTGCCGCGACATCGCTGGTTGCAGGAGTGAGTCACAATTTTACTCACTGTGCCATTTTGTGTTTCCCGT
CCTACTAACAATATAATGATCTTCTCATGTATTGATCAGGTTGCAACGGGTGGCACTCTGTTCTTCGAGCATACGAAGCGCCGCTTCGAGCTCATGCTGT
ATTGCTTCCCACGCGCGCTCGACATCGTGTGGCAACTTTTGAAAcgccgcggcctcgtgcGCTATGTGAAGCACAGTGAGGTAGTGCTGTTTTGCCTCTC
CATGTCGCTCATCATGTCCAGCCCAGCGCGTTATTTCAAACCGACGTACCTCCGGATCCTGCGGTTCATTTTTGGCGGCGACATTATTTGATAAGCTACT
TGCGTGATACTACTCAATACGTTCAAGATACTCCAAAAGTATGGTATTTTACTCACTCATCAATCGACTTTCTTTTGAACATGCTTGGCAGTGATACGCC
AACTTTAGTACTCCAAGTCGTTGAGCACAAACAAATCCAGCATTTGCTTGGCCTCCTTAGGCTCCCACATCGGGACGAGGTGGCCAGCTCCCTTTACAGT
CACGTAGGTGATCCCTTTGAACGTCTCTACGAAGCCACCGGTTTGCTTTGAGTCTCCCTCCGCGTAAGACCAGGCTGATCGTGGTGCCAGGCGAGGGAGA
CCCAGCGACTCCACCGCCCAGAGTCCACCCAGCGCATTGCAGACCAAGTCTGCGTCACCGTGGTAAATGACGCCCTTCACTCCGCTCTCCAGTAGCTGGC
GCCACAAAGGCGTGACTTCAGCATTGAGAGTAGGCGTATACTTCAGCATCTGCGGGTGTTGCAACATCGGAtgatcgacgccaagaaTGGAGCTAATCGC
ATCCATGCTCGCCGTAGTGAGGGCGGAAGCGCTCCAATGCGCCAGCTTCGGGTTTGCGTGCATCGAGTCTCGAACCTCAGCAAGGTTAAAGTACGATTCA
AGGTGCTTATTGTCCAGGCACATGTCCATCGTGTTTCCAATGGGGTGCGGCACCTTACcaggcgtcgacggcgtcaacaTCTCCGTCACAAGACGTTGGA
TGTCCTCCTTGGGCGATCCGGCGCACGATCCGTAGACGTCGTACATATTGATGCGGTCATAGACCAAGGTAGTGTAGATGTCCATCGTGGCTGACGTGCA
CTCCGGACTAGCGTCGTTGAGACCAGGCGCGATTTGGGGGCTCCTTTCGAACTCGTGGAGGTCGGGGCAGCTGGTTCGGAACTTCTGGTACATCACCGTG
CTCAACAGTCCATGGTAGTACGCGAACATAACTGTCGAGAGCCCCATGTACTCGTTCACGCCGTTGCCCAccacgaacttcttcagGTTAATATGTTGCG
CTTGATctggcgtcgctgcattGCCTTTCAGAATGGCAAGAGCCGTGGTCGGCACATAAATTCCTCCGTAGCTCTCTCCAGTGACGACAAAGTCTTTCTC
CCTCAGCCAGGGGAACTTCCCGAAGAACGTTTGCAGGGCGCCGTAAAGATCCTGGGCCTGGGAGAGATCGTCCGCCTCGTACACCCCACTGGAGTTGTAG
CTGAAGCCGACGCCCACGGGCGACTCAATGCACAGCAAGTTGGCCTTCTGGTTCCACGCGAACTCGTTCACCCGGAGCGCCTTCCCGTCCTCGTTGACGA
GCAGCGGTCCGTTCTCGGAGAAGCAGCCCGAGAGGGAGCTGGCCCCCGGGCCCCCGTTGAGCCAGAGCAGTACGGGGTCCGTCTGGGGCGTCGGGCTCTG
GGACTCGGCCAGGAAGTAGAAGGCGTGGCCTCCGTTGTGCAGCGGCAAGTAGCCCGAGAAGAGCCGCGCCGTGTACTCGCTGGGCTTGCCCGCGAGCGTC
AGAATCTCGTCCGCGGAGCCCAGGAAGGGCTCGCTGATCAGCTCGGGCGTCTCGGCGTCGGCTGAGTCCTCCATGACCGTGGGCTCGGCCGGGCGCTCGC
CCGTGCGGATGAGGTTCTCCGTCTGCAgtgagcgctgcagcgtcaccatGAGGTCTCCCACGGCCAGGAACAGGAGGCACGCGACGCCGTAGCGGATGAA
GCGACGCCCCGTGGTCGACAGCAGGCGTCGCGAGCGTCCCGCGGCCGGCAGCGTCTGGCGGGAGCGCAGCCCGCGCGTGAGCGGCAACGTCTCGTTCAGC
GGGTCCGAACGCAGGTACATG