Description :
From Genome Similarity Track
Location :
Scaffold_12:414620- 419396
Sequence
4776 bases(100 bases per row)
AACCTGTAGTACGTAGCCTACGAAACCACGACACAAATTTTCACCTTTCAAAGCTGCCCAGCAACAGTACTACTTTTCGTTGTGGAATACTGTCGTTTAA
TTTCCGCTAAGCCCTATCAGCCCACCTTTCTAGTTTAAATGAATATGATAACTCATTGTATTGTGTATAAAAGGGTGGACGGGGTTTGCATGAGCTACAC
GTTCTTGGGTTGCTGCCATGTTGCGGGTAACTCGGTTCAAGCGCTCCGCTACTTGTTCAGCCCTGTTGGGACAGCCGCCTCGCAATCTCACAGACGTTCG
ACTATCGAGAGTAGATGCTTCAGTTTCACGTCGACCGCCTCTTCCTCCACTATTGGCACCCTTGCCACCACGTCGAAGAGCCTGTATTACGGCCACGTCG
TGACGAATTGCAGTCTCCATATCAAGCTTTGGGTTTTAATTTGACAGCGACTGTCAAAACACTGTAAAAGCAATTTGGACACTCACAACAAGTTTTACTG
CAACCGAGAATATTATCTTGCATTGGCTGCTTAGATGTAAAATCCGCTCGATGCTTTGTTTTATAATTGTTTGAATGATGTTATAGTTTAAATAAGTCAT
CACGTACACATACAAACCATTAAACTTCGTATCTTCACTTCACGAGCCAATATGATTTTTTTGTAATTAATCACTTATCTAGCAGATTCGTAGGAAAGTA
ATGCTACCCGATTTGATTGGATAAAATTATGCAGTTCGCTGTGGCGTTGTTGTAGTAGCCTGACCCTTACGTTGGTTTGTCTCCTGAGCGAGGCTAAAAG
CAGTAGTGACCGATAGCTCTGGTAATCGACGTTTTCTCGATGTAAGTGCAATTTGTAAGCTGTCCATACCACCGCGAAAATCTCTGTTGCTTCTTCCTCG
GACATGTCTGCTCCTACGCTCAGCCCAGTCGACTCCACAGCGCTTTTAATGTGTCGCCCAGAACAGCCCAATCGGAGAACATTTTGTGCAGACGTTTGTT
AGGTAGATCGTGCGACCGAATGTGGGGGGATTTCATGTAGCTATCTCCAAACCACCAAAGTTTCCAAACTCCAAACGGGCTAGTTTAGGGAACTCAAAAG
CAAATGGAATTTTCCATCGTAGTAGTGAACTGGTTGACTATGTTGTCGTCTTGGTTACTTGCTGGTGCTTGTGAGTGTGGCATTCCCGAGGGTACAAGAA
GTCTCGCTATCGTTGATTCAAGCTCGTCCTTGGTAATATTCCCAGCCGCGACTCCTCTTTCTTCGATTAGATGGCTAATTCCATTTAAAAGTACTAGCGG
TAAATTATCAATAGCATTTTGCGTGGACAATAATTGTTTATATAACATCATCCATGATGAAGACGTTGTCACTAGTTTTGAGCGAAGTCAGTTCATATTT
TCCTCATGCCGAAATAAAAATGTCGAGAAAGGGGGGGGAGCAGGCAACGTATTCCTGAGGTAATTAGTGTGCTGTAGCGGGATTACCAAAATCTGCGCGA
TTGCTAGATCCAACTTACCAACAGCACCCAGACACCGATTAACGGAGGGGTCCCCGATGATCCGTGATTTCCTCACCTTGTGTACCCGTCGGTAGGGCAG
GGGCTTGCTCTCACGGTAATTTTAAAAAAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGATGGAGCAGTCGTGGTAAGGCACTC
TGCGTCCGTATTTGTTTCTGGATCCCAAGCGAATATTCGAGCTTAGTGGGACTGCCTTATAGGTGCGTCCCTTGCCTATGGGCTTGTTGCGTCGTACTTG
CCGCTTCTATTAGCGGGATCTTGATATTTGGGAGTCGATAGGTATACCCGGCCAAGTAGTGAATCCGAGTAACGTTATGGATTTGCACGCATAAGAAAAG
CTCACTAGGTGGTAGGATTTGGCCAATATATTATCCACTTATCACTACTCGCGCTAAATCTGCAATTTCCAACCTTCCCCGAGCTCGTACGGCCAATATC
GTTCCGAATCTTGAGGGCAGAAAGGAACTTGCGTAACACAATGCAAATTCGTCTCTGATTCTTAGTTAACCCCTTGGTTCCCTTTTGTTGTACTTCCTCC
GTCCGATAATATAAGCACGATGGGCGGGCACAATTAATTTTAAGAACAGAAAACCTTTAAGCGGGCAGCTGATTGATCTTAATTGCTGTTTAGATTACGG
CAATTGTTTTGGTCGCCGTTTGAAGCAAATCGGCCACCTGGTCGCAAAGTTATCGATTTGCAAAGTTCGTGGTGTAGAAGTGAAATTTGAAAATCTTTCG
CCGGGATGTCAATTTTCCACGAAATGTTAAAGAAACCTGTAGAGATGTAGCGCGTGTGATTCCCTATTGAACGGTGCCATGTAGAGTACCTAAATATCCC
TCCGATCTGGTTTGCAGCGGCCGACAACAACAACAACATTTGAATGGGCGTACTTAGGCGGAAAACGACAGTACTATCAAATGTAAGCATACCGCTTTTA
TTTTCGAACATGGTATAAGCAGATACTCCGCTTATATTTTCGGACATAAAAAGTACAATAATACTTGGTATTTATATTAAAACACTCTTCATGCACGGAT
TTTGAGAAACCAAGATATTTTGTTAAGTATAAACGTCCAATTACACAGACGTAGGTTTCTCTCGAGGGGGGGGGGTCGGTTAAACAAGATATAAAAAGAA
TTACCAAACGAGTGACCAGTAGCCACCAAAGTGCTCATTCTCCAAAACGACGGCTCCTGCAAAGATAGCTGCTCCGGTCGGGGAATCCCCCCAGCATAAG
CTCACAAAAGAAGAACGGCGATGGTGCCTTAAGGGGCGGCTGAGCGAGAGGCACATGTGACGAATTTGGCGGGTAGATGGAAAGCCGAGTGCGAGGGATG
AGGGTACTCAGAAGAAGGCCCCCAGAAAGAAGGCAGCAAAGCGCACAACACCTGCCATCGAGGTAGCCCATAGCAAAGGATCATCACCGGACCGTGGGAC
CTCTCGTGGGGATGTGGAGTGTGTGGGGGAAGCCGAAGAGAAGACAAGAGCTTCTGGGGAAGCTCGTGACGCCATGGAAGCAGCACCACCAGCGCAGATG
GCGTCCCATTTGTCAGAAGATCGTGTTGACCACGCCGCAGTTGCTGCAGAAGCTGAAGCCATCGTCGCCTACGTTGAAACTACTCAATTTGGGCGTCAGT
TGCGAAGGACAACGATCTCATGAAGGAAATGCGGTACAGTGGATGAGAGTATGGTAAGTTATGTTGTTCATATCCAACATATGAGCGATACATTTTCCCT
TCGGTCAACATAAGAGCTAACATAACTATTGTTAATTGTAAATATTGAGTAGATCCGAGTAAATTTGGATCTGACCCGACCTACAATGATCGTTTTGATG
GCGAATTCGGTTCAAGTGAGAGTGTTCTCAGCGTTGCTGAAGATCCACTTGCTCTTCTGGTCTAATTTATGCCACCCAAGCTGTGGTCTCAGATGGCTGT
AGAAAGAAAGCGTTATCGGGAGCAGGCGGTACCGGCACGAGCGTGAGCAATTCGGACGCAACAGTGGAGGCGACGTTGAAGAATTTGGAGAGATCCGTCG
TCGCTTGGTAGACGCCAATGATATCGAGCCACACGTGTTTTTACGCGTCATGACTCTCCTCATCGCGAGGATGTTGGTGCCGATTCGGAAAGGTATTGCT
GCACATTGGTCCACGAAGCAGGTGGACGCACTGCCTTCCAACCATCTCGGGCAGTTCATGGCCAAGCACCGCTTCTTCCACATTATGGGCACTTACTTTT
TCAAACAACAAGCCCACCAATGGAAAATCCGACCTGTTGTGAACGTGCTGCATCGTACATTTGCGCGTGGATACAAACTGCCGCCAGTGATCAGCTTTGA
CGAGGCCACGCTTCCGTCGCCTTCTCGGTACAACACTACACGCCAGTTCAACAAAGGCAAGCCTCATCGTTGGGGTACGAAGTTTTTCGTCGCTGCATGC
GCCAAAACGGCTTACTACATGAGGTGGATGTACAACTTATCGTGGCAAGCTTCGGCTTGTCACGATTTTGTTGGCTTATGTGCTTATGTTGTCTCCAGGC
AACATAACTAACTCCAACTCACTGTTGATCCTTCATAAAGTAACGTATGTTTTATTTGGTGCTGTCTTGGAGGCTCAAAATTTACTGTGGAACCAAGCCT
AATCTGCGCACACCTGTACCACCAGACAACAATACCGGCGAAGCGGCCGCTCTTTGCAATATAAACACACTGATACCACCGCCCCCAACGGCTATGTAGC
GTCTAGTAGTGACAGACAGGTTCTACACGTAAGTCAAATTGGCACTAGAGCTGCTGTACCGCCATATGTACACCACGGGCACAATTCAGACTGATCGAGC
GGGTTACGCTAAGAAAGTACAAAACGGTGAACCAGCGCCGGATCATGCAGCCGCCCCATGGCACTTTCAAATTGGCACATAATAAGCAACACCCTCAGCT
TACGGCCGCTGTGTGGATGGATCCTAATCCTGTCCACCTGCTATCCAGCGGTGGCGGCCGAAGGACGTCTACAGTCAGTGAGTATTGAGTTATTGGTGGT
CTATTCATTGATTTTTACTGAGATGATATTATGCATGTATTTAAGTGAGGCACATTGATGGCGAAATGAAGCCCCTGACAGTGCCAGAGCTGGTCAGTGA
CTACCATCGATAAATAGGCGGGGTCGACGTTCACGACCAGCTCCGGATGCAGCACTTTAGTGTGTAGCTGTCGTAC