Description :
From Genome Similarity Track
Location :
Scaffold_266:41449- 47508
Transcript NameFunction/comments
g13426.t1hypothetical protein
g13427.t1hypothetical protein

Sequence
6059 bases(100 bases per row)
CAAGCGATTGAAGACGCTGCACTGTCACGAGCCAAGCAAAACGAGGTCATGATGGAGATGAAGCGTGATTCAAATGTTCTTCACGGCTTCAATGAGGCTG
TACAGCGCATGCAGACGATCACACAAGAATATTCGTTTCAATACCGTCTCCCGAAGACAGATCTGCGAGAAGATGTCGAATCTGCGATGTGCTCGGGCTG
CGGTCGGATCACTTGTGACTGTCACCTAAAGAACAACGAGTCTGCCGATGAAGGCGGAGCCCCTGAAGGAGCCACAAAGAAGCTGGATGGAAACAGTGCA
ATGATCAACGCACGGAGCCGAAACAGGTTGGCCAAACGTTGGCGATACCAAGATTGATTTGTGACAACTCAACATTCGACCTGAAGATGTCGTCACGGTA
TTTTCACGGGTCGGTTAATCGTCTGACCAGTCCGAAGCTTCCGACATGCTCAAAGAGTCCTCGCGGTTCCGTAGCCCAATCATTTGCTACAAACACCCAG
ACACAAAGGAATCGTCAGATCAGTTCATCCCGAGCGAGATACTGACAAGTTGTCCAGGTGAACTAAGTCTATGAACAAAACACGCACCGATTCAAAATCT
GCCACAGGATTTTTGGCTTCTTGCGTCTTTGGGGGCGGTGGTGGCTGCTTTGGCGGGGCAGAAGTTTGACCATCTTCCTCTTGTTTCTTCTTGATGTTCC
GGATCTGGGCCAGGAAATCGTCGCCGTCGTTGGACTTGTCGTCGTCAGAGATGTGGCCACGGCCATCATCACTACCATCGTCTGACATTGCAAGCGTTGG
CAGCCTGTTATGTTGCTGACCGTCGTCAGACGGCGGTGGTGGCGGCGGCGGCTGGACTGGAGCTGTCACCTCCTTGGCAGTCAGCACCGTCACAGGTTTC
GCGGTAGCCTTTTCTCGCTCGCGCCTCTGCTCCATTTGGTCCTGCTTCCCGCTGATAGCAGCCTGCCGCCGCAACATTCGTTGCTGCATTTCTTCGGCAA
TCGTCAGCGGTTTGCTAGCGGTGTCCCCCGCCTTCGCAACAGGGTCGGCCTTCTTTTCTTCACTCGAGTCAATCTGCCATTTCGTTAGACAACCAATAGT
TAGTGCATCAACAGCGTAGATGAGCACGTGACCTATATCGAGTAAGAGTGTACCTTTCGGAGCTTGATTTTGGGGTTCCGAATCTGGTCCAGGAAGCTGA
CGACAGTAGGCTCGTTATCCTTTTCTTCCGGGGCTGGCGGGGCAGGTGGGACGTCCTACAGAGCATAAGTAGCGGAAACAATACGCCGGTCGTATGAGAA
CCTTTATAGCATGACGTGCAGCCGATCATTGAAACTGTACCTCTTGCGGTGGTGGCGGCGGCGGAGCGTCTTCGTCCTCACCATCAGCGATCGGTGGTGG
AGGTGGGGGTGGAGCCGAGTCATCCTCCTCGTCTCCTTGCGGAGGCGGAGGCGGCGGCGGAGGTGGTGCGCCATCATCGATCTTTGTGAAGTCCACAGTA
GGCGCAGGCGGAGGTGGTGGGGGGGCACCGTCCACCGGGCCAACCTGGAAGTTTTGATCTGATGGCTCTTGCGCCGCAGGTCCCTCCGCAAAGCTCGCCA
CGGTGGGCAAGTCAGGCAACGCCTTGTCCTGAAACATGGATGGCGCGATCGACGTGTTGCCTTCCTGCGCGTACTTGTAGTCGGCAATGTTCTCGAGCGG
CAGGTTCGTAGGCAGCTTCGCCGACATGTCCGGCATGATGCCCATCGTCGGATGGAATTCATAATTGAGTCCGTGCACTGTCGGCTAAAAACCCAACCAC
AACAATAAATTCTATCAGTACGGCACCCATCCCTCGCCACAACCAATTGCCACCTCACCAGTTCATCTCCGTACTCAATTGTCCGGGGTGCCTTGGCCAG
TTCCTTGCGTTTCTCCTCCTCTTCCTCATAGTCTGTGCCCAGCAAATTGTCCCACGACGTGTACTGCGCCACCACCAAAACCTCATCAGCCTCATCCCAC
CCACCCACTTCAACCTCCCTACCTTCTGGTACGGGTTCTCCCCGGAGTTGAACAGCAGGACACTGCCCACCGACGGGATGTACTCTGGCAGTCGTCCGAG
TCCCTCCTTCTCCATGTCCGCTTCTGGCTGCTGCGTCTGCTGATACTCGTTCACCTTCTCGAAGAGCTCCACCACCTCCGCCATGTGCTGCCCGCGCTGG
GCCGGGGGCATTGGCTCTGCCGGCAGGAAGTGCGTGTCGTCGTCCGCGTCCGGGACCAGCGGGGGCGCGTCCGCGTACGGTTTGTCGTGGAACAGCGTCT
TAGACAGCGGCAGCGTGTTGGGCGCCGGGTACTTGGACGTGGAGAAGACCGTCGTGGGCTTGTTGCTGGCGCGCCGAGCCGTGAGTGCGTTCACCTTGGC
TTGGCACACCTGGATGCGCGCGTCTACGGCGGCCACGCGCTCCTTCTCCTGCGAGACTTTGTGCACCAAGCGGTTAAACACATCCCCCACCACGGCGTCC
AGCTGGGACAGCGCCTTGAGCACGTCCTTGGCCACGAACTGCGGCTGCAGGTCGCCGTACACGCGGTCCACCGCGTAAACCTGCGACGTCTGCATTGTTG
CTACAATTTCAGATGTGAAGTGAAGTTTTGGGGATGGATTGCATAATAGAGACAGTGGTTGTGAGACTTTATAGGGTACGGTGTAAACAAAACTGCGAAA
ATTGATACGTGGACAAAAGGTGGACGATTGCAGACAGTGGGTAGTTGTCCGCGTGAACAGTTTGGAGTCTATCAGTATCTCCCATTGTTGGCGTTGCCCG
CCTTAATGCTGAAGTCTAGACACAGAGGAACGTGATCCGACAGGAACTGGCAGTTGGGCAGCGCCGTCTTCGAGTACGCCTTGAGCACTTCGGGCGAGTG
CACCTTGAGCCCAGCGAACGACGTCAGTGTCTCCGGTGTATACCATACGTAGTCCACCACGCCCGTCCAGTGGCCTGGCACAAACAGAGAACACAGTGTT
AGACTTGCTGGCTCACTTCGCGTAGGTGCGTGCGCCCGTTCTTACCTGTGTAGTTCGTGTACTCCGGCTCGGCACCGAAGACGGATGCATAAGCACTGGC
AAAGCCGATGTTGTGCTCCAAGTCTAGCGACGCGTAGATATTCGCGATTTGCGGTGGCGGGCACTGAATGTCCGGGTGGTCGAGCGGGACGTGGTTGCGC
GTCATAAAATCGTACACTGCGCTGGTAGGCTCGCTATTGAAGTCTCCACAAAGTATCGTGGGCAAGTTCCGACTTAGAGTCACCCGCTCAAGCTGTCAGA
ACGCATGCATACAACGGAAAATGAGTCACACACGCCTGAATTTTCACCCCTCACGTTGGCTCGAACGTACCTGCTTCGTGAGCATATTTGTCTGCCACAT
CTTGACGTCCGGAAACTTGGGATTGGGGAAAATATGCACATTCGCGATGCAGAGCAACGGCCCGGACTGCGACTTCCGTGCAACAACATCGTTATTAGCG
GGAACCACCTCTAGCACCGCGATCTGCGCCACATTGTCGCGCTGGAGCCGCTGTCGCATCTTGTTGAGCGTAGATACGAACATTTCGCGGGCAGCCATCG
AAGGTCCGTGGTAGTCCAGATCGTACTCGGTTTGCACCTGCTCCAGGAAATCATTCGCTAAATCATTGAAATCGACTGGGTACCGTTCCTTGAGAATGAA
CCGGTTACGTTTGTAGAACAACGCACAGCCGTCCACCTTGCCTTCAAGTCCCATCGATTCGCGCGATTTCTTCAAATACCAGCCTTCATAGCCCCATTCG
TCCATCATCCGGGCAAAGAAATTCTTGTAGTGGTCGCCCTGAACTTCCTGAAGGCAGATAATATCGGCGTTGTACGATTGCAGCTCGCGCCTGAGCAATT
CCCTCCGGAACGACCAGCTAAGAGCCCAGATCGGGCAGTACGGATACATCTGCCGCGTCGCGTAGATTTCGGCCAAAACATTGTACGTGAGCACGCGGAA
GACGCCGATTTGCCGCAGCCGCGGTGTTAACCGTTCTTCATTCACATTCGCCAGCATCTGCCGCCTTGGGGGCATGGGCGGGACTTTGGGCGAACCACAC
GCATCAGTTCAGCACACAGGAGTGAATTAGCCTAGCAGAGCAATAAAGTACACACTTACACGGCAGCACGATCCCAGTGTCGACTGTCTTGGTCAGCACG
CCGCCGCCAACGCGCTTGGTGGCCTTGCACTCCACTCGAATCACGTGACCCACGTCCTCGGCAGTTGGCGTGTAGGACCGACTGTAAGACAAGAGCGGCA
GGCGCGTGAGAAACTCCGTCTCGACCAAAAGGGGTCAACGACATGGTTCCATCTAGCTAGGGCCCTACTTTGCTTCCTGCACCTTGAGCCACGACTCCTT
CGGCAGCGGACAGAACGTCTCCATGTTGTGCAACTGCGATTTCCACGAGAAGTTGTCGCCATCCCGCGTCTGAGCCTCCAAAAGTGCATGTACGTCGTGC
AGCTGCTTGTGCTTGTGCCAGGCCAAGCGGAAGCAGTCCGGACTGCAAAAGCACGAGTGCTCCCGCGTGATGCCCAGTCTGCAGCACTGCACACACTCGA
TCTTGGCCATGAGCAGTAGTACGTTGCCAGCGCCGTCGCTCGTGTGGCGAGTGCACTCGCTGTTCGCGCAAGCGCGGCGCATGGAAGACCTGAACCAGTG
GAACTTCATGTCCACGTCCTTGTCGTCAATGTCACCGTCTCCGGAGCGGAAGAAGGCGTGCGTCATCATGGTGCAGCCCTCCACGGGCTGGTCCACCCGC
AGCGAGATCTTCCCCTCTCCGTGCACGGGGGACCCTTTGGGCGGCGACAGCGAGTGCGGCTGGCCTCGCACCGACGAGGGCGACGGCGACATGGGGTGGC
CCTTGTTCATCAAGTGAGCGGGGAACGGTTCTACACTATAAAAGGCAACAAAAGATAGAGTGTATTGCCCGTAGAGCGTCAGACGCGTTGGGCAGTCTCT
AAACACGCGTGCGACAGCCACGTTGGCTGCTCCCGCTTCTCGGGAGACACGAAAGACACGCATATGTGCATGGTGGACGGTAGAACGCACCGTTACACAG
CGCGTAGGTGCCCTGGGGGCTAGCCACGGCTCGGTAGGTCGGTGTGGAGTCGCGTGTCTGGCTGAATCTCGGAGCAGAGCGAGGCTACGACCACCGGAGA
AGCGCGAGCAGCAGACGGAGACAATAATCCACGTGCGCAATTGGTGAGAGGAGGCGAAGGGGGCTTGGAGGACGCGTGGAGGGCGACGACGAGGCCGGCA
ATGAGCCTGCGTGGCGAACTCTCGGAGCTTTGTGGCGAGAGTCGTTTTGGCTGGGGAGCCCTTCTGTCATACAAACGCCAAGTCAAGTTGGGAATCACGG
CGCGGATTGGACGAAAAGTGGATACGAAGCGGATGTGCGCCACACCAGAAACCACTTCAACGTGAGTGTAGCCACCTTGGCTGTTGCCGACAACCAAAGC
GATGTCAGACCTGCACGCCCGAGACCTCAGAGATGGCGGCTGATGAAGGGAAGGGCAACGAAAAATCTCCTCAGTGCATTCGCTTAGTGTCCGCGGGGAC
CGCTGGGTCAGCCAAGACAATGAAAATGATGAAGAAGGTAGGACTGGACTGGGAGGAGGGAGCGCGAGCGAGTCGAAAGAGGACTCCGGCAGCGCACGTA
CGAGTAGCTCTACGACCCCTGTATTGCTGGTTTCGGTGAACCGGACGAAGGCGACAATTTCGTCGACCAGCTCGTCGATGGAGGCGTTGGTCTTCGACGG
CGAGGTGGCGAGGATTGACGCCGACGAGAAGCTTACCATCGCGAGAACGAGTGCGACTCCGACTCCAGCGAGGACGAACGCTGACTTCGTTCGACGACGA
TTTCATGACGGCTATCGAGCTCGACGATGTAGAAAATGCTCCTCGGTAACAATTCACTGTCGCCGAATCTGATACCAGTCAATCAAGTTGAGAAAGCTCC
ACATGGCCGAGCGCTATGCAAAGTCCTTGTCCATAGCAACGCACGCAGTCACATGGCCC