Description :
From Genome Similarity Track
Location :
Scaffold_18:41447- 43282
Sequence
1835 bases(100 bases per row)
GGCCAGTAAAAGTCGTGACTTACCGCGAGATAAGTCTTCTCACGCCCACGATGCCCACTAGTTGGTGCATTGTGGCACTCATACATGATGCGTAATAGCA
AATCATTATGGGTGGGGACGACGAAACGAGGTGTGTTGCCGTTAACGGACGTATAATACAGCAACTCGTTGCGTGTTGTGTATCGACCCGCGGAAGACCG
ATACAAGGCCGATAATTTTTTGAGAAATTTACGAGATGGAGTCACCAGATGATCCATTAGTCGCAGAAGAGCCTTATCTACTGCATAGAACTTTTTCATG
TCGTCAAGCAATGTTGTCGACGGAACACTAGTGACTAGCGTTGCAACAGTTTTATCAACCCCACTGTTGGACTGCGCAGCCGACTCGAAATCGGGTGGCG
CGACAACATTAAGTCGTCCGGGTTTGTACTCCACGGAAAAGTTGTACTCCGCAAAGAAGGACAGCCACCTCGCCATCCTTTGCGAGAGGTGGGGGCTGTC
TACGGCCGTGCGTAATGACGCATGGTCCGTATAGACTACAAACGGGCCTATCTCCAAGGAGATAGACGCGAAACTTCGCCAGTGTATACTTCATGGCAAA
GCGTTTCTTTCCATGCACTCGATAATTACGCTCAGCTGCTTGCAGCTGACGCGATTGATAACAGACGACACGCTGTGCGCCGTCTGCATCGTACTGCATT
AACGCGCAGCCGATTGCAAAATCGCTGGCGTGACAGACCACATGGAATGGTCTGTCTTGGTCTGCAATCGCCGTCTTGGCGATTGCATCAAGCTCTGCTT
GATACCTTAAATGAACGCTGACAATCAGAATTCCATGACCACTTCTCGTTCTTTTTTCAAGAGACGAGAGAGATGAACGGTCATCTTGGCGTAGTTGCGC
GATTACTTGTGTAAGTACGTCGCTAGACCAAAGAATTTTCTTAGTCTCTTAACGTCGACTAGCACAGGCCGGTCGATAATCGTCCTAATTTTTTTAGGAT
CAGGGCGTACGCCGAGTTTACCCACGATGCACCCAAGAAATGGTATTTCGCTAGCAGCGAATATACACTTCTTGAGGTTGGATATTTCTGCTCATAAGTG
TAAGAACCTGACGAACGTGAGTTCTATGAACCTCTACGTCTGCATTTCCGCCCATAGCCCGTCTATGGACGAATACATCGTCGAAGTAACTCGGTGCTAA
GTCTCGCACCGGTCTCAACAGATTTGTGACGCATCTATCGACGGTGGCAGAGGCGTTACTAAGCCCTTGTGGCATTAATAGCCACTCCCAGAGCATACTG
CTCGGGGTGCTTACTGTCGTGTACAGGATGTCCCGTTCACGCATTAGGATCTGATAGAAGCCATCCATCAGATTCATGGACGAAAAGATGGTACTCTTTG
ACATACCATCAATGATTACGTCTTTCTTCGGTATCGGCGTCTGAGTCAGTACCATTGCAGCATCCAACTTGTTGAATGCGTGCACTATCCGCCATCCTCC
GGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGCGGAAGTTGACTCCCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAACTTGTCGATCGCA
AGTACTTGCTCACGAGTCAGTGGCCACTGCTTCATGACACAGTACTTCGAGCCCGGTTTGAGCTCGATTTCATGTCGAGTGCCTTTATCCTTAGGCAATT
CGCATGGTACGGATTCAGGGAATGCATCCTTGAATTCGATCAAATCCTTATATAAAGGATTTGCCTGAAGCGACTCCCAAGATTGAGACGTGTGTCTCTC
AATCCAAGTCTTCTCATCGAGGACACTTTCGTCCA