Description :
From Genome Similarity Track
Location :
Scaffold_188:41446- 46693
Transcript NameFunction/comments
Hyaar_Emoy2812186hypothetical protein
Hyaar_Emoy2812187hypothetical protein

Sequence
5247 bases(100 bases per row)
GTCGAACATGGTTACCACGGCATGAAACTGAGCAGTTTCATACTTCTTGAATCACCAGTATCTCTCCATTTGCACATTCTTTCACATGATATCAATGGAT
TCAGCACAACCAAGTGACCCAACAAAACGAGAACTTGACCCCGAGCTCCATGCTGACGTCATCCGACGGTCGTGGTCTCGTGTTCGACACGTATGCGCTT
AAGTGATTCCTTCCGTCGACATTGCCGCGTATGTTAATCTAGAGAGGTGGCAAGATGGTTTGGCGTGGCCCAAGGTTGTTGACTATTTGCAAGCCTCCCT
GACCACCACTTGGTCATCCCGAAATGCGGTTTAATTTGCCACTTTGGCATAGCTGCTAAAGAGTCACCTTTCTGTTGAAAAGCTATTGAGCAACATGGAG
ATCTCAAAGCCTGCCGCCTGCCCTTCACACTTGACCTCACGCTTGATACAAGTAGCCAAAGTAGTTGCAACCATTGCAGTATAGCACATTCACTTGCCAT
GAGGTGGGCAAGTGAAATGTGCTATACTGCAATTTCTCGATGCTTCATGAGCGAATAGTTTGCCTAAAACGGAAATTGCTGGAGCTGTAGGACTTGCTGC
GATGCCATCCAGCAAGATGCTGACATCGCAGCAAGTCCTACGGCTCCAGCAATTTCTGTTTTAGGCAAACTATTCGCTCATGACTTTTCATCGAGGCTGC
AATGCAAGTGTCTGTCGTTTCCGATCAAGAGAATATGCGAGGACCTGTCCACTGATCGTGCTCGCTAAGAGAGTGCCCTTGTCTACCGTGCACAAGCTTG
TGATCATGCACTTTGGGGCTCCTTCTGCATATGCTTCCGCCAATGGAGATAAAGACGATGCGTCCCTTACCTTCACAATACCATCCGTGGAGGCCGTCAC
AGGCAGCGGTAGCCGTCCACTTGACTCTCTGTCGTCTTCATTTGAACTCTGATCTACTGTGTTGGGCAAGAAACAGCAACCTATTGCATCGTGATCACCG
CCTTCAAACTTGACCACCTGCTTACCAGTGCGTCGATCCCACACCTGTGCCTCATAGCCGACGCCATTCAAGCCCTTCCTAGACGTCAACAAGTACGTGC
TGTTGCTATCGTGCTCACTGTTAGACGCTGCAATACTCTGCGGGAAATGCCGAAACCCTCGCAGCGTCTGCACCGGCGTTTCTAGCGGCGTTCTTAGATC
CCAGAGCTTCACACTCGAATCTTCACTGCCTTACGCACCGAGCGCTTCACCTGGCGACCACGTCGAGCACGTGACGACTTTCTCGGGCGTCGTGGTCTTG
GCTGCAATATAACTCGTCGTGAGGTCCCAGAAGATCGTCTGTGTGTCTCGTCCTCCTGAGCACAGCATTTGCTCGGCGTCATCAACTGCCACAGAAGCGA
AACAGAGTCGATGACCTCGTAGTACTGTCGCCGTCTCTGAAGCCGGTTTATCCGTGATTGGCGTAATGGCTACCGTCGTGTCAAGTGAACACGAGTAGAT
CATCTGCAGCTTGGCTCCAATAACCACTTGAGTCACAGCCTCCGAGTGAGGGATCCACACGTTCAAGCCGTTGTCTGGGGCTCGTGCTTTTAGCCGCCAA
TTGAGACGCTGGATCAAGCCATCGGTACAGCCGGTAAGGCAGGTATCACCCAAGAACGAGCTGTACTTGATGCAGTTCAGAGCCAGAAGATTACGCGCTT
GGTCGGCTATACCTACTACACCTGAAGCTGCTGCACCACTCGGAGTGAAAGCGGTTCCATCAATGAGACGTGGCGTCTCGTCCTCGACGGTCCAGTTCCA
AAGACGTCGCGATGACCCATTCTCGTCACGAGAAGTATTGGACCCCATGTGTACTATCTGTCTCAATGCTTTTTGGATGGAGCTGCAGATAAAAGCAGCT
CTCGGGCACCACAACACGAGTGTGGTGACGCTCGATTTGTTGACTCCAATTTGTAAAGAGGCAGCACATGATGCAGCGACATTGTTTGTCCTCCTTCTCT
CGCACGTCATAGCTGTGGGTGCCAGGTGCTGGAACTGGGCATTGTCGTTTGATTGATTGACAAACGCATCTCGAATTAAGTATCAACGCTGCACCGACAT
CCTTGATGCCTAACACTCTCAAGTTCGTAGATGTAAGAGAGCTATTAGATGGAATTGAACCGATATCGACCGTGAAACGTGTCAACACATCACCAACTAC
TAAGAGGACATGCTGCTAGTGGTGAGCATAGGATTTTGATATTTGTATGTGAAATACTGAAGCTGGATCGATCCTGAGGTTAACCTTACATGAGCTACAG
TTTCTTTTGGACACGGATTGCTTGCAATACAGACGTTTATGATGCAGACATTATTTGAAAACAGCCGTTATTGTGAGAAGTAGAGACGCTTCTGGCTAAG
ACGAAGACACAAACCATATGACAGAAAAAGATAGAGGAGCAAGCTCTGGAGCTCACACTTTGATATAAGTAATCCAGTTCGGAGAACTGAATCAAGCTGC
AAAACACTACACAACAGCAGCAGTCACTGAAGAATGTGTATGATGCTCATAATGTCTATATTAATCCAGTACTACATACTATACTCAAGCAACGCGATCA
GCCTTTGCTAATGGGCGTTGAGCATTTGCTTATGTGATCGTATTCACCTTTAATCAATTTTAAGCCAATTACGTGCGTGTGTCACAATAGTGACCTGGCC
AAAGAGTGACACCTATCATGTTAATCGACCTATGAGGGGGGACAGGCTAGATCGTACTTAGTACGTGAAAGGTACACCTAGCCGCGCTATTTACAGGCAC
ACAGACACAGATAAGTACGATTAAAAAGTTCGGCATTCGACCTTGCGCAAGTCACTAATAGCTTCAGTTTTCGGGCTCGCAAAGAATTTTTCGAGGGACA
AAAATTCATACGAGAATACTCCTGAGCACAGGGAATCATATTCCTGTATAAAATGCACAATTGGGCGGGACTAAGTGTCTGAGTGGTGGCAGCCATACGG
ATGGGTATTTGAAGTACCATCCGCATTGGCCGTGTAGGCAACAGAGATCCTGCCAAAATAAAATAGGGAAGTTAACTGTTATTAGACTGAAGAAATCCAA
ACTTAAAAACATTTTCTAGGAATTAAACCAACTCTGACCTTCTATTACTTAAGATCCTCAATCTCTTTCTACGCAACTGTCTTTTCTAATTCACGATATA
AATAATCCTAAATCGTTTTTAGTAATGTACAACTTCAGCGTAAAATTATGATTTCTTGATTCTCACACATTAGTTTCGTCTATGTTGAAAACATCTTTAG
GCTCTTAGCGAGAAACTACCACCTGAAATCCAGGCAATGCTGCATCCATACCTTCCTCATTTGCTAAACCACTCTCATCACTTTTCATTTTGTGACGCTT
TTAGCTTCACCCTGTCCGCTTCGTACGGGTTGCCGGGTTGAAAAGTAGCAACGTACATGCCCACCCATCCCTTTCCTGTCTTTAGGGACGACGCCAAGGA
GGTTTCATTCTTCCCGTCAGCATCATGCGCAGTATGGCAGACCCCGTCCCGGGCGAACCGCCGGCGCATGGGGGTGAACCGCCGTACCCAAGGGGCAGCG
GTCCTGCCACGACCACTTCCGAGGGGCATTCTCCACCCGGAGACCCTCCTCACCAGATCTCCGATACGGCAACCGCGACGCCATCTTCGGACGGCAGCAC
TGGCGACCGGCAGCCGGGGCAAGCTCGGCAGGCGGATTGCCCTGTGACCCCCTCGAGTCCCGCCCCGTCGGCGGCGAAGCAGGCTACGGAACAGACGGTA
AACGCGGCGCAGAGGCACCAAATGGCGAGCGAGGTGCGTCCACGGAAGATGTTTGCAGCTCTAGTCGCAGCCCGTAAGGCTGATCCGCTGGGCCCCCCAC
CGGACGCCTGGACTACTACTCTCGCTGAACTGTTTGCTAGAGCCCATGAGGCGGTTTCTATTGACGAGGAGTTAGTACCGCCCGAAAAACGTCGTTTTCT
CAAACTATGGAGCGAAGAGAAAGATCTCTTATTCACGTTTTTATGATAAGGCATGCATATGTGGGGAGAGCTCTTTCACTGACTGGACTAGACAGATTAC
AGCGGCGACTCGAGATTTGTATAACACGAGCTGTTCATTCACGCACATTGTACAGAACATGCTCAGCAAGTTGAAATGGGCTCGGTTAAAACCTTTGAAT
CTATGGACACCTCGCGGAGAGGGGGCGTCTACGGATACAGCCGCCATACCCGGTTCACCTGGGTCGCAGGTTGCCTACCTTGATTTTATGTTCAATCCGG
CGCTGTACAGCAAGCCTGACATTGCGACGTTGCGGTCGCTCTGCCAGCATCCGGTAGCTGCACGGTGCGGGCTTCGGCTACGAGAGGCGGTGGATGAGGG
CGTATCATTAGTGGTCTCGCGGAGGGAAGCATCGTCAGTAGGCGTTTACCCGACTTTGTAAAAAGCGTTCTCGACTCCAAGGAGCGACTCCGTCTTTACC
GCACCATACAAGCCCAGATGGAAGGCGAATTGGTTTTGCAGTAGCGCAGTGGCACGACTATACGCGTTTGTCTCCAAAGTACGAGCGCCATCAAGGAGTA
CATGCCCTTGCAGCTGAACAGTCGAAGGTGAATCAAGACAAGCTGCGAAGCCTGCTCAACGTTGCGAAGACAATTTGTCACGACACTGTTCGGTGTCGGA
TTCATATCGTTTTTCTTGACCGCCAGACAGCGAGTCGTTACGAAATGGCGACTATACCGTTTCGAGGGGCGCTTTACAGGGTGTCTAACATGCATCCGCC
GGTCAAAGGGTCTGTCTGGGCACGGCAGCTTGATACCGGAGGCATCCGACTGGCGGCTCAACGAGAGTATGTTGTGGAGCTCCACAATGTCACCCGCTTT
ACGGACGTCAGTCGACTAACAGCTTACTTTGAGGCCCACATTGCCGCGGGAGTTGAGCTCGATGATATGGACACATGCACGCCCAATTCCCTGACGTCTA
CTGTGTGGAAACTAACCGTTAAACTCGCTGGATGTCCTGACTTTTTGTGTGGCGTTGTCCGGCTCATATGGTACGGCAGCACTATAATATTGAAACATCC
TGAGGTTGGGAATCGCCTTCAGTGTTTGCACTGTGGAGACGTCGGGCATCCCATGGCACGGTGTCGCTATGATGCAGATCAAATTCGAGGACCGGGCAGC
CGGGTGGCAACGGAGCAAGAAGTGGCTGGGCTCGAAGACTTGGCTGT