Description :
From Genome Similarity Track
Location :
contig_1:41444- 43340
Transcript NameFunction/comments
g3.t1hypothetical protein

Sequence
1896 bases(100 bases per row)
TCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACTGAGGAGTTAGGCACGAGGTTGATCTCGTGCCAGGCACAAAGTACTGTGTGAC
CAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCATGAGTCGAAGTCTCCGCAC
ACGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCA
TCCCTCGCAAGGATGTGTTGCTGAACAACATGGCGGGCTGTGAGCTTTTTAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCG
CGACATCCCGCTCACGGCGATGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGACACAGGGTCTATCAAATGCCCCAGCGACTTTCAATCGC
TTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATAACTTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCTATCG
AGGTGCATCTCGAGCACCTCCGTCGAGTGTTCATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAA
AGTTATCGGCTGCTTCGTCAGCAGCGTCGACGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATTTT
CGCAAGTGGTTGGGCCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACT
GGCGCTGGAGAACCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGTGCGCGCCGGTCCTGGCCTTGCCGGACGAGACAAAGCCATTCAGC
GTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTA
AAGCTGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACTCCTCCTGGGCTCTGAGCCCTT
TGTGATCTATACAGACCACGAGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAAC
TTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCACGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAG
ATCTGTACGATCGGATACGCCTGGCATATCGAGATGATGATAATCTCTCTCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGTCAAGCCTGCATGGCT
AACGCCCCGCCAACGTGCCCGACTCCGTCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGACCCGGCCAATCCTCCGCGGATAGTCGTCCCC
AACGAAGAGGATCTGAAGTATGACATCCTTCAGGAGGCGCACGATGTGCCTTCAAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCGGTCTCCCAGG
TCTTCTGGTGGGCCCACATGTACAAGTGGGTCGTCACGTATGTGAAGGCCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTCGGCTCCTTT
GCAGAGCCTGCCAGTCCCAGAAGACTGCTGGAAGTCGATGAGTCTCGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCT