Description :
From Genome Similarity Track
Location :
Scaffold_197:41438- 44734
Transcript NameFunction/comments
Physo_144553hypothetical protein
Physo_144554PREDICTED: similar to Enhancer of zeste homolog 1 (ENX-2)

Sequence
3296 bases(100 bases per row)
TGCACCACGTACTGGCCGCCGTCACCTGCACGCGTCTGGGTGGGGTCGAACGCCTCCTGCGCCACCTTCATCACCATTCCTGACTTGTCACGGCACATGA
CCATGATGTAGTTGAGAAGCAGGCGCCATGGGTTGTTAGCCTCAGGAGGCAGGGCCTTCTTCACACTCTCCATGTCAAACAAATCGCGCGCCGACACGGG
GAACGAAGTGGGCTCGTCCTTTTCGCGCTCGCGCGGCGACGAGTGCTGCAGCATCGCCGCCACGATGACACCAGCCACAGCGTTGATGTTCTCCGTCGCA
AACCTAATGCAAGCCTTGTGCCGCAGATCGCGCAGGAGCTGCGTCACGCCAAAGCGCCACACGAGCGAGCGCTCGTCGGTGTGCGCGCCCGAGCCGTCCG
GCGCATCCTCGCCGCTGGTCTCACCACCGGTAGTGCCATCTCCAGACGACGTACCACGACTGGGAAGCTTGGCGCGCTTCGAGTTTTTCTTCCGCTTATT
GCCACGTCCAGACGAGGTAGAAGAACTGGCAGAGCTGGGTTCCCACTCGGCCTCCGAATCATCCTTTTCCTTACGAGCCGCCTCGTCCGCGTCCAGCATC
ATCTGCAGCTCCACCGGAATCGCATTACCTGAGGACGGTGCCGGCGCCTTCCGCTTCTTTCCACGCACTGTGATTCCGTCCTCGTCGGCAGCTTTACCAT
TTTTGTTCACGCCGTTTGCGCTTAACGCGCTTCCAGCCTCCGCATTGGACGCGGCAGCAGCAGCCGATTTGCTGTTCAAGTTGCTGGTGGCGCCCTTCTC
ATGTCCGCGCATGATGCAGGCCGGGAACTCCGGCGCCTCCTCCGGCTCCGCCACCTTTAGGTCGAGTGGGTGCACGCGCGAGATGTAGCGCTTCTTGGCC
ATCTCCACGAACGTCTCGCGCACGAGGTGGCGGCACTCGTCCAGCTCCTCCTCGCCGATCTCCTCGTCCTCGGCGGCTGCAGCCTGCTCTGCGTCGGCCT
CCTGCGCCGTCTGCTTCTGCTCCTGGCGCCGCTGCTCCGCCAAGTTGTAGGCCATCGTCTCCAGCGACTGGTCCATGCGCACGCGGCCCTGCACCAGCAT
CTCCTCCATCACCACTTCGCCCTGCACGCCGAACGTCTCCTTGGCCAGCTCGATGAACTTGGGGAACCGCAGCCGGTACAGCGCCTCCTGCACGTTGATC
TGCCCCATTGCAACACAACAAGATCAACGTCAGCACAACAATAACAATAACAATAATGCGCCACTCGTACGTTGTAGGCGACAGTGGGCGCGCCGCCGCG
AGCGCCAGCCACGGGCGTCACGTCCAGCACGTTGTGCTGCAGCAGCTTGAGCAGCGCGCACTTGATCTGCACAGGCAATTAATTGCAAAAACACATAAAC
AGTTAGCAATTAATTATGCATGCAATTGCAATTATGGCGGGTGCCCGCCTGAGTCGCCAGCGCAACGCAACGCACCTCGTGCACGGACGGCGGCGAGGCC
GCGGAGCTGCGGCGCTGCAGCTTGTGGGCGAGCTCGGCCAGGCGCAGGCCCTCGGAGCGCAGCAGCGCCTCGGCCACGCGCTCCGCCACGTCGCCGAAGT
CCTCGCGCACGATGCTCAGCACCAGCGCGCGCTCGGAGCGCGAGGCGAACGCCGCCTTCCTCTCGGTCGAAGCCATTTGTCCGCAAATGTGGCAATTGTC
CGCCATCCAACGCCCGTTAGATCGGAGATGTTGCGCCAGTGTCGTTTGTTGTGTGCACCACACCAACACTAAATATCGAGAAATCTACGTGTAACATTCC
TACGACCTCCTACTCAGGAATTCATTACATGTAGTAAAAAAAATACTAATAGCAACAACTAACACACAAATGGCGGGCGAAGATGCGAGCCGCAAGCGGC
CGGCGGCCGACGGCTCCGACTCGGACGAGCGCGACAACTCGGAGCCGTCCCAGACGGAGATGGAGGAGCAGCTCTGCGCGCACGCGGCCGAGGCGCTCAA
TCACTTCATCCGCAGCCACCACATCGCCGCCAGCGTACGCGTTGATTGGCTCGCGGCATTGCAGTTGATCATCGACGTAATTTATTTTTTGACGCAGTAA
TTTATTTTTCGTTGTCGATATGACTAGACGGAGGTGGCGCGCAACCGACTCAAGAACTCGCTGTACCTGATCGAGCAGCGGCGGCGACGCAAAGAATACC
CGGCACGGGCCAGCGAGGTGTTCCATGAAGCCATGCAAGGCTTTGGAGTCGTGCAGAGTGAGTGAGGTGTCGTTGACATATTATTCTAAATGAGAGTATG
ATGTACTAATATTTATCTTGTTTATTGCAGCGTCGGAGCTGCCGGTGTCTCCGGACCGCCGCGTGAAGCACACGATCAGGATCCAGCTGAGCAATCCCAG
CGAGATGCTGGTCAAGCGCGCCGTGATTCTGCCGAAGGTGCCGCCGATCCCAACCGCCACCATGTGGACGGCGCTCGCCAAGAACTACGAGGTGGAGGAC
GAGCCGCAGCTCAAGTTCCTGCCCTACTTTGGCGACGACGACGAAGAGGACGTCGTGTCCGAGTTCTACCAGATCAAGTGAGAGTTTATATTTTGCCTTG
GGAGCGATATTTGCATCGGACCTGACGGGGATACTTTGTCTTGACTTTAGACAGCAACGGACGAGTGCGTGTGAAGTCGAGTTTACCAAGGAAATGTGTG
AGGCCGTGCTGAAGACACTTCAGTCCACGTGGGACCTCACGCCGAGTGATCTCAAGCGCGTGGCCAACGTTATTCAAGTGGAAGAGGAGGTCGGGCAGCT
TGTCTTCGTGTTGCGTAGAGTATGCGCTGGACTGGTCTATTCACTTGCTGTCGTTATTTGTCAAGTAGGTGCTAGTTGAGGTGCACAAGAACTTGCGCTT
GATGCAGCGCGCAGCGAAGAAGAAACGGCGCACAGAAGCGATGGCCGCTGCAAACGGGCACAGAAATTTGACTCCTACTGGTGAAGAAAATGGATCCAAG
GACGAGCTTCAAGATTCTGCCGACGAGCCCAATATCTCAATGGAGAATTACTTCGAGCTCTACGAAAAGTCCGCTGATTCGTTTCGCAGTACGTGCTCTT
TATCGTGGGGTTGACTTCGCAATTTAAACTGTAGCACTGACCATTGCGTGTGCTGTGTTCTGGGTGCAGGTCTTTTCTGTCGACGTTGTTTTGTGTACGA
CTGCGACTACCATGGGTGTCTCGAGCAGCCAAAACTGGTAAGAATGTATTAGACGAAAACTTTTGTATTCGAAACTCATACTCTGTGTGCTGCGAT