Description :
From Genome Similarity Track
Location :
contig_40:414326- 415426
Transcript NameFunction/comments
g7393.t1serine/threonine-protein phosphatase, putative

Sequence
1100 bases(100 bases per row)
TATCATTGCTCTGATCTGCAAGAAGCTCTACCGCGCTATGGGTGCTGGAGATATGCAGCAAGCGTTCAAGGTCTTTGACGCCGACTCGAGTGGCTTCATT
GAGTACGAGGAGTTCCTCAGCACACTGAAAAAGATGGACACGGGGCTCTCAGACCAGCAGGTCTTCGCGCTTATGCGCACGGCCGATACGAACGACGACG
GGAGAATTGACTTCAATGAGTTCGCTCAACGCTTCGAGGTCATCTTCACGGACCAGGGCAAGAACCGCGAGGGAGATTCGGCAGTGGAGCCACCTCCGAC
ACCAATGGAGCTGGATACGGAGGCTCCTGCCGAGGGCGAAAGACGGAAACAGAGCACATTTTTGCGCGCCGGGTGTCTTCAGGGGACGACCAATCGACTT
TCACGCCGCAGCCGGCAAGCAACATCGACGTGGAGACCATGCAGGCGCTGTTGCAGGTTGGCAAGGCGCTGTTTGCCCGCCGCGGCTCGCTGCAGTATCA
CTTCTTCCACTTCGACAAGAACCAGGATGGTGTCCTGTCACGGAATGAGTTCGAGCACGCGCTGGAGCAGCTGGGGTTTAACTTCGAGCCCGATCTGATG
GAGCGCGTTATGGCGGCCGTGGACAGCGACGGTGGCCACTCGATCGACTACAAGGAGTTTGTGACGGCCTTCAGCGTGCAGGACGCGAAGGAGCAGCAAA
CGCTCGAGTCTGGAGATCTCACATGGCAAAACTCGGTGCTGCAGCAGGTGTCCAACGTGTTCTACCAGCACCGCATCCACATTCGCAACGCCTTCCGTAT
GTTCGACGCAACGAACAGCGGGGCCATTAGCCGCGACAACTTCCGAACTGGCATCCAGGCCTTCAACGTCGTGCTCAACTCTCCGCTCTCGGACGACCAG
ATCGAAGAGCTGCTGTCATATCTGGACAGCGACAAGGACGGCGTCATCAGCTACAAGGAGTTCTTCGACGGTTTCCGTGTCGTGGACGTTCGCATCGACG
AGGACAAATGCGCCGAGACCAAGTCCGATGAGTCTAGCGAGCCCGCAGAGGACTGACCTGACAGGTGAGGTCGAAGCAAACCGTTGAAATAAATAGTGGA