Description :
From Genome Similarity Track
Location :
contig_166:4143- 7049
Transcript NameFunction/comments
g11867.t1PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
2906 bases(100 bases per row)
TGTATCCGAACGAATCGGGTCGGATTCTACGCTGAGTATGTTTGGAACTTCCGGAGGATCAAGCGAGTCGATGGCCAGTGCTACATCCAGTTCACGGACT
TCCAGAGATAGTTCGTCCGGATCTTCCGGATGGAGTGTTTGCCAAGGTGCAGGAGTGCATATGCCGTTCTCAGCGTTTGAACCACGGGCAATGACAGCTC
AGAGTCTGGGAGGAGCCGTCCGGCGGAGACTGGTGTAGGCATGTACGTCACTCACGAAGTGATTCCACGGAACCCAGTACCAGTGATTCAGGAAGACATC
GTCATGTCAGAGAGACGAAGCAAAGGGTTCTCGAAGACAGAAGCCCAAGGTTTCTTCCCGAAGGATCTCCCGATACCGGTCGTACAGCCGCTCGTTCATA
CCGCAGTAGTGCTTCCGGAAATGCTGCTGAGACGACACATCAGAAGCCGGATGTGAGAGGCTCTGATGAGATCGTCGCGGCACAATTGCAAGCTACTTTG
CAGGCATTTGCTGCTGACAGAGTTTCGAAGAACCTGATGGGAAAAACCGTGAAGATTTCTGAGCCTATTGTGAACGTGAAAGCGGAACCCGTTTCTGAAA
GTAGAACTTTTGCAATGGGAAAGGCCGAGTTGTCCTCTGGAACCAAGTCAACTGCACCTGGAAAGTCGTCAAACGGCACATGTCCGAAAAATCTGGTTCG
TCCAAGAAAAGTTCGACTTCCGGAAAGGGAAGAGGACGAAGAAGTCATCTGGAAAGTCAAGTGATCCTTCGGATTCTCCAAGTTCTGAGTGACTCGTACT
CGGACAGTTCAAATAGCAGCTCTTTCGAAGATGTCGTTCCGAATGTCCATACGACACCGGGTCCAGGCGGATCTCTGTTACGTTCAGACCGTACGTGAAT
GCCAGCACGTTGGAAGACTTCAATGAGAAGCGTCACTAGCTACCCGTATCCGGTGGTTGGAACGATTCCAGAGTTTTGCGTTCAAGGCGGTTGGTCGGAT
AAGGTCAAGATCTATGAGATGAAGCTGAAGTTACCTGCTGCCGTTCGGAACTGGCGTTCGAACTTGAATCCCAACGTGCGCCGGAAATGGAAGAAGTTCC
TGAAGGAGTTCCGAGATATGTATTGCAAGGCCAAGACCTCGGATTCAGAACGTTATTACACGATGATCCAAAAGAAGGCAGAAACTCCGCTGGAATTTTA
CTACCGCCTGAACAAGGTGGCCGACAAAGCGGGATCGAGTTCGACGCATCGAGTAAGCAACGTGAGCGCCATCTGAAAGTGTTCACGAAGAAGCTTCTGG
ACTCTCGCCTCCGAACGACTTTGCAAGGACAACGTCTGCGTCGTCTGAAGGACCTGGATATGTCCTGAAACAGCATGAAGAAATGAATCAAGACGACGAC
TACGATACTCCACCTCCGAAGAGAGACTTCCGAGCGGACAATGTCCCTCGTGATCGATTCAGACCGAAACGTTCTGGAAGGCCTATGTCCTTCACGATGA
CGATAACCGGGATGGCGCACGACAGACAAGTCCATTTTTTGGAAGATGTGGAAGAAGTGACAAGTCGAGAACATGTTCCTAGTGTGCTGACTACTCCAAC
TGCGGATGCCACGAACGTGTCCGGTTCGAGCATGGATAACCTTTCCGAAGCAGTATTTCGTGCGATGGAGAATCCTGGATGGCGGCCACCGACTTCTGAT
TTCCGTTCGGATCGCCGGCGGCAAACGTTTGGAAGTCCGAACGCGTCCAAGTTCTGTGACAAGTGCAAGGAGTTTGGACATCTGACGGAGAATTGTTGGT
CGGACATCGAATGGACATCCGACGCACCTCTGCAGGACTCGTCCGTGTGCGATTTGTAACCAGTTTCACGAAGGCAAGTGTGAAGAATGGAAGGCTTTCA
AGCGATCAAGAATCTTGCACGTCAAGGAGCACTGAAAGATCTGCCGTCTCCTATCCGGAAGCAACTTCTGGAAGGGAAAGTGGATCCAGGGGAACAGCCG
TTAAACTAGTAAGCCCGCTGGATGGGGATCCAGAACGCGACGGGCTGAAGAAACCCCCGATATGTGTCTTCTAGTGTATGTTGGTCCGGAGTTGAGACGC
CAAAAACAGGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTCGTCCTGAACGAGTTCTGTCGGAAGGTGTAC
GGCCGGAATACAAGATCCGGATGTACCTGTTGAATTCCGACTGGGACCAGGCGAACGATATGGCTGGTGGGAAGATCACTGTTCGGATGACACGAAACGG
ATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACAGACATCCTTTTGGATTCTGGAGCGTCAGTAAGCATGGTGAGTTTGGATCTTGCGCGTAGAC
TCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTATCTGGACGGTGGCGTTCCGACCATCATCACCGCGAGTGCTGAAGTGAAAATCACTTTGGGTC
CGAGAATTGTGTATGTCTTGGAACTTGGGTCGCGAACATTGGTGAAGGTGTCGACGTGTTGCTTGGAATGAATTTCATGTATTCCGCTGGAGTGCGACTG
TGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATCATTACCACAGAGGTTTGGACCTTCCGGTGA
GACCGCGTGAAGAGCTTTTCCTGCGTCCAGGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAATCCACAACGTGATGTGGTATGGGCTGGTCG
GGGAGACCGATGGGTAACCCAGATCATCTATGCTGCTAGATCGTGGGCTGTGGCCATCAAAGTGGTGAATTTCCGGAAGGTGTCTTAGCATTGACACTCG
GACGCC