Description :
From Genome Similarity Track
Location :
Scaffold_76:4143- 16781
Transcript NameFunction/comments
Phyag_g1644hypothetical protein

Sequence
12638 bases(100 bases per row)
AGAAAAGCACGTGGCTAATGTCACGCGGCAGCTTGCAGCCAAAAATGTGGAGATCGAAAATGCTGTCGAGGACGTTTTAAGGCTTATCTGCGATTACAAC
CTAGACGGCACCTCCTCAAACACAGCAGGACTTGCCAATGGTGGCGTGTCAAGCACGCCAGGGTCAACTACAATTTCTTGTGATGTTGAATCCATGGAAA
CCTTCCGAAGCTTTTATCGGAATCTCTTCTATCGCTCGTTGGTGACGTGTACTAAGCAGTCTCTGGGCGCTATCAAGAAACGAGTATGCTCTAAAGCCGG
CACGGGGTTTCTCTTTCTCGAACGTCCTTTCTTCGAGGTGGATGTGCAGCTTTCGGTGCCATCCGTTCGGTTGAGTCCATCACTCGATGATATTCAAAAG
GCGATCAACCGTTCCGCGGTGGCTGTGCTACGCTGTTCGAAAAGCCTGTATGAGTGGGGGCAGCAAAATATATTCCCAGAAACCTTACGAACGACTTTGT
TTGAACGTCTTGGGTGCGACACAGAAATCATCAAAGTGGCTATCCTTCTCACGGGTGCATTACACGGCACAAAAAACCAAGTTCATGAATATCTATCGGC
TTTTAAAAAGTACGATTGGCTTTGGAAGGAAGACATGGAGTTCCGTTACAATCAGTTCATGCAACGCAATCCGCTCATTCAGGATTTTGAGACTGAACTG
CGTCATTTCATGGCGGTGGAAGTTGAAATTTCGCTAATCGCTCCCGTACACAACATAGCTGTTCTGTCTTTAAACACAAAGAACCTGAAACTTCAGCTAC
GCAACGAATGTCGTCAGTGGAAGGTGCAGTACTCAGACAAGGTTCACCAGCAAGCTCGAACAGCTTTGTTTAACCTGACAGATTACATCCGCACCACAAC
AAACAAATTAAACACACGCGTGGAGTCTCTGGACGCCCTTCGTTTCGTCATGGGAGTGTTGAAGGAGGTGCGCGAGCGCGAGTCAGCTatcgagatggag
ctgaaTCCGATAGCAGATATGTATGACATGCTCGAGCACTTTCTTCCTGGTGGATACATGGACAAAGAGGAAATGGACCAAAAGAGTGTTTTGCGCGGTT
CATGGCGCAAACTCGTCGACTACGCAGAAGAAGTGACGGACAACCTGTCCGAGGTGCAGGGTGGCTTTAAAAAACAACTGATCAAGGATGTCAAAGACTT
CCAAGCTGATGTGGCAGTGTTCCGTAGCGATTATGAAGCTAACGGTCCCATGGTCTCTGGGCTCGAGCCCGCAGAGGCTGTGGAACGTCTTAAACGGTTT
AAGGACCTGCTTGGCATTCGTGAACGTAAGCTTGAAGTATTCTCAGCCGGAGAGGAACTATTTGGTATGCGTCCAACAGAGTATCCTGAAATCATTCGAA
CTCGCAAGGAGATGGCACTGCTAGATCAGCTCTACGGACTTTATATGGATGTCGAGAAgtccatggacgagttccgTGGTATCGCATGGGCACAGGTAGG
GGCGAATGTGGAGCGTATGAGCGACTGTTTTGCTGGATATGACCAACGATGTAAAAAAATGCCGAAGAATTTGTGCGAATGGGAGGCTTATGGTATACTG
CGGAAGGTCATTGCGGAATTCCTAGAGGTGTTGCCAATCGTCCGTGAGTTGACAAGGGAAAGTATTAAACCCCGTCACTGGGAAGATATTATCAAGGCTT
GTAATGGCCAACGGCTTCCTTACGACAATGACTCGTTTAAGTTCCAGGATGTTCTGGATGCGAAGCTTCTCAAGTGGaaagaagacgtcgagtACATTTG
TGAAAGTGCACAAAAACAGCTCCAAATTGAACACAAGCTTCGTGATCTCACCGATCGTTGGGCTGGGACGGCGTTTGAATTCAGTGAGTGGAGAGCACGT
AATGTCCCTGTACTCAAGAGCTATGGCCAGATAATAGAGGACCTCGAGGAAggtcaactgcagctccaagcaaTACTGAGCATGAGGCACGTGGTGTTCT
TTAAAGACAAAGTACAAGCTAAACTTGCACAACTGTCTGATACCGCAGATGTCCTCGAATTATGGGCCAAGGTTCAAACACTGTGGATGTCACTTGAATC
TGTTTTTACGGGAGGGGATATCGCCAAACAAATGCCGCTCGAAGCGAAAAAGTTTGCGAAAATAGACAAGGACTGGCTGAAAGTCATGAGTAAAGCGTCT
GAAGTGGGTTTCGTAGTCTCGTGCTGTTCCAACGAACTACTGCGTAGTACACTTCCCTCACTTTTTGGAGAGCTCGAGAAATGCCAAAAATCTCTGGAAG
GCTATCTCGAGCaaaagcgcaagaagttccCGCGCTTTTACTTTGTGTCTAACCCGCTACTTTTGCTCATTCTCTCTCGAGGGTCTGACCCGGCAGCTGT
GCAGCAATACTACGAGAAAATCTTTGACAGCATCAGTCAGGTTGTACACGAAAGACCATTGCCAGCAGCGGTGGACGCTAAACCTTCCTCCGCAGCGTCT
GCCACGACTAATCCAAACGCAAAGCGCAAGATTATTGAAATCAAGTCATTAGTCGGCAATGATGAGGAAAAGATCTCGCTGGTGCAGCCCGTTCTCCCTG
ATGGGAACATTGAGGATTGGCTGGGTatgttggagaaggagatgcgACGTACTCTCAAGATTCTTTGTCGGCAAGCTGCCGCTGAATGTTCGTCCGGCTC
ATTACGCGATTTTGTAAGCAAGACTTGTGCGCAGTTCGCGTTGCTCGGCATTCAATTGAGCTGGACAGCCGAATGCCAGGATGCGCTCCAGCGATGTCGA
ACAACAAAGGGTATCATGGCacagatcgccaagaagcatGGTACCATGCTGTCAGAGTTATCGTCATGGTGTCTTACAGATCTGGGCACAAAACTTGCTC
GTACCAAAGTGGAGACTCTAATCACAATTCAAGTGCACCAACGCGACTGTTTCCTGGAACTATGCAGACTttacaaggagaagaagctcacggATGCTAA
CGACTTTGAATGGCTCAAGCAAGCTCGTTTCTATTGGCGTGTGGGTAACCAAGGTGCTTTCGACTCAGTGGGTCCAGATGCTTGCTTGATCTCTATCTGC
GATGTTGACTTCAAATACGCTTTCGAGTACTTAGGCTGTAAGGAACGGCTTGTGATCACGCCATTGACAGACCGCGCTTACATCACGCTATCGCAAGCAC
TTGGTATGCACTTAGGAGGAGCCCCGGCAGGCCCTGCAGGAACTGGTAAGACCGAGACTGTTAAGGACCTTGGACGCAGTCTTGGCGTATATGTGATCGT
CACGAACTGTACAGATCAACAACGCTACTCAGATATGGCGAAAATATTTAAGGGGCTGTGTCAAGGCGGCCTCTGGGGTTGTTTCGATGAGTTCAATCGC
ATTGAGCTGCCAGTGCTTTCAGTGGTTGCACAACAGGTACTCGCAATCACAAATGCCAAGCGAGTTCAGGCTCCAACGTTCACTTTCCCAGGTGACCCAC
TACCTATTGTATTACACACAGATGCAGCTTACTTCATCACCATGAATCCTGGTTATCAAGGGCGTCAAGAGCTACCAGAAAATCTTAAGGCGCTCTTCCG
AGGCGTCTCCATGATGGTCCCAGATCGTGAAATTATTATGAAAGTTAGGTTGTGTGCTGTGGGCTACGACGCATTTGCAGAACTTGCTCGTAAGTTCAAA
ACGCTCTATGCGGTGTGCGAGGGGCAGCTATCAAAACAGCGGCACTATGACTTTGGTCTACGCAATATTTTATCAGTGCTGCGCTCTGCTGGTGCTACCA
AACGCGATAATTTACTTGCGAGCGAAGAATTGCTGATGATGACCACTCTGCGGGACATGAATCTCTCCAAGCTCGTGGCTGCTGATGTGCCCATCTTTTT
GTCTCTACTTCGTGATATCTTCCCCGGAGTGGAGCCGGCACCTAATGGTGGTGGGAACAATAGCAGTAACGAAatcgctggtgctgttgagGATGTCCTG
CAAAAGGCTCAGAGCTGGCCACCTCCAGCTACATGGAGCGCCAAAGTTACCCAGCTGTACGAGACCCAACTCGTACGTCACGGAATTGCACTTGTGGGGC
CTGCTGGCTCTGGTAAATCAGAGATTTTGCGTACTTTGCAGACTGCATTGGGTTTCTACACGCGCACGCCACACCGACAAGTACGCTTAAACCCGAAGGC
TGTTCGTGCTGAGGAACTATTTGGTGAGACTGACCGACTGTCTGGAGAATGGGTCGACGGTGTATTCGCGGCGATTTGGGCAAAGTATAATGATCGATCG
AGGAAGGATGTGGCCTGGTTAGTATGTGATGGGCCAGTTGACGCGGTTTGGATTGAAAACCTCAACACAGTGCTAGATGACAATAAGCTATTGACGCTGG
CTAACGGTGATCGACTACCTATGACCGACAACTGCAAGCTTCTTTTTGAGGTTGAAGACCTGCGCAATGCCTCGCCGGCCACAGTTTCACGTGCAGGAAT
TGTGTACGTCAGTGACACAGATCTTGACTGGGAGCCTGTAGCACAGCGATGGCTTCGTATGCGACCAGAACCGCAGCGTGCAGCATTGGCCCGAAGTCTG
CGCACATTTGTTGGTGGAGGTACATCTACGCCAGGGTCAGGTTCGGGGCAACTTTTTGAGTTCTTGGCGCGACGATGTCGGCCAGTTATGATTGCACCTC
GAGTAGCTTTGATTCAGTCATGCTtgaacctgctgcagtctctCTTGGAGCGTAGTGAGCTCAGTGAGAACTCTCAAGCTGATATGGAGCTGGAATTGGA
GCGATTGTTTGCTTTCGCTCTTGCCTGGGCAATTGGTGGAGTGTTAGACCTTGAAGACCGCGTCAAGTTGCACTATTACCTGGTTGAAAAGGCCCCAGCG
ACTACATTCCCACCATCAATTGCCGGAACACCTGAGTCTTCGGCGCCAGGTACCAATACCGTTTTTGACCACTTCTTACATCCTTCGACGCTCGAGTGGG
AGAAATGGGTACTCGACACTTGTGAGAACCTACTTACAGGAACAAGCGGCATTGTCAATGTTGGGCGTCTTATTATCCCGACCACCGATACTGCTCGTGC
GCTACACATTCTGGAACATCTTCACGCTAGCCAACTGCCTGTACTACTCGTTGGTGAGCCCGGTACAGGCAAGTCCACGCTCACCCGGTTGTTTTTCGAG
AATCATTCCAGTTTATCGGGCACTAGAGAAGGTATGTCATCCAGGACGCTAATCTTTTCTGGATCTACGCTAGGTGGCGCCTTCCAGGCCACGGTTGAAG
CAGACCTAGAGAAGCGTGGTGGAAAAACGTTTGGTCCATCAAATGGCCAACAGCTTACACTGTTCTTGGATGACCTGTCCATGCCGGCACTCAATGAATG
GGGTGACCAACCTACGCTTGAAGTGGTACGCCAATTGGTAGAGACTCGTACGCTGTGTTTCCtcgacaaggacaagcgTGGTGATATCAAAGTCATTGAG
GGCTTGCGTTTTCTGGCTGCTATGGAACTCCCTCTAGCTGGTAAAAATGACGCTCCAGCCCGGCTTAAACGACACTTCTTCATTCTGAACTTGCTGCCTC
CGACACCAGAAGTTGCTGAGGCAATCTTCGCACAACTCGCTCGCTGGAAATTCGTCCCCGACGCCGACAGTGGCATCACAAGCGGAATTCCAAAGAAACT
TCTCTCGGATTTGATCACTCGTCTCGCTGCGGCATCCGTGCAGCTCTGGCTTTGGTTGCGACGAGCAATGCCTCCGACGCCTCAAAAATTCCACTACGTG
TTTAGTTTGCGTGAACTCAGTCGGAGTTTCCAGGGCTTGTTGCGAGCACCCCTGGAAACCGCGACAGCTTCAGAAAAGGCAATGATTCGACTGTGGCAAC
ACGAAAGCGAGCGTGTTTTTGGCGATCGACTTGTTTCGATCGAAGACAAACAGCGCTTCCGGGACGAACTTACCGCTATTGCGGATGGATTGGTTACGAA
ATCAGTTGGAATCGCAGGTAGTGGGTCAACGTCGAGTGTTGGAACGAACAGAGAGAAAACCCCTGGTCCAGACGGAAATGCACAACGTCAACACTCAGTG
CAATCAGTACCGAGCACGCGGCAGGTCGTGGTCTACGTTGATTTCCTTCAGGATCAGCCTGTTGATGAATTTGGTGAACCTGTTGGAGAAATGCCACGCA
AATATGAACCGATAGCGAGTTTGCCAGCACTACGCACACGGGTGGAACATCTTTTAGCACAATTCAATCGTGAAAATCCTGCGCGTGCATTGCCTTCTCT
TATCTTGTTCGAGGAAGCGCTGTTTCATTTAGCCCGATTGACACGTGTGCTTGGACTTGCACAAAGCAACATGATGCTTGTTGGCGTGGGTGGATCAGGT
AAGCAGTCACTGGCACGgttggctgcagcacttAGCGGGCACGAACTGTGTCAACTAGCAGTCACAAAGGCATACACATTGTCAGCTTTCCTTGACGATT
TACGTGGGTTGTGTAAGACTGCGGGTCAGGCTGGGAATGGTGTAGTTTTCCTTTTGACCGAAGCTGATATCAAGGACGATTCCTTCTTAGAGCAGGTAAA
CGCACTCTTAGCGACGGGTGAAGTACCTGGGTTGTTTCCTCGTGACGAATTGGGCGCCATGGCGAGCGAGTTGCGTGGTGTCATGCAACGAGAATGTCCG
GATCGCCCTGATACGCTGTATAACCTCACGCGTTTCTTCCACGACCGAGTCCGACGAAATCTCCACATCGTTTTGTGTCTATCACCCGTGAGTTCACGCT
TTGCCGATCGCTGCCGCGAATTCCCACATCTAGTAAATGGCTGCACAGTCGACTGGTTCCTGCCGTGGCCAGAGGAGGCACTCACCGCTGTGAGTCAGGG
CTATCTCGAGAAGTTTGTGCTTGAGACTCCACCAGCCACTAAAGACGCGTTGGTACTGCAAATGGGCCGAATGCATCAAGCTGTTGAAAAGGTTAGTGGG
GAGTATTTTAcccgccgacgacgacgcgttgtCCAGACTCCACGCAGCTTCTTAAGTTTTCTCTCAACCTACAAAGAGCTGTacgcggagaagctgcgtg
aagtACGTCACCAAGAGGGCGCTGTAAACCTTGGACTACAAAAATTGGGGCAGGGGGCAAAAGACGTGGAGCGAATGAAAGTTGTGCTaaaggaagagga
ggccaAGCTTGTGGtagctgaagcagcagctaacAAGATGTTGGAGACTCTGCAAGTTAAATCGCTTGAGGCTAAAAAGGAGAACGATATTGTACAACAG
ATCCGTGAACAATGTCTGGCCGATGCTGCGATCATCTTAGCCGAGAAAGAGGCTGCTGAGGAAGATCTCAAACGCGCTCAACCGTTCCTGGACGAAGCAG
AGCGGGCTGCAAGCAGTATTCGGCCTAATGATctgaacgagctcaagaaatTAGCGAAACCAGGCGACATTATCAAGCTCATCTTCGACTGCGTGGCCAT
TCTACAGATGGCACCGCTACTTAAGGTCGAGCGTGCTCCAGTGACAATGGGTGTAGGTAAGGAGAAGCACACGAGCGACTTCCTCATGGACTCGTTTCAA
CTCGCCAAGTCAGGCATGCTCGCTGACACCCGGTTCTTGCAAAACATTTTCTACTTCTCGAAATACCAAAAGGATCAGATGAACGACGAAACGCTTGAGC
TGATGGCACCTTACATGGATCTTGCGGGGTTTAGTGCTCCTGTGGCTAAGAACGCATCTAAGGCTGCAGAAGGTTTGTTTTGTTGGGTCAAAGCTATGAG
CATGTATCATGAAGCGTCCAAGGTGGTAAAGCCAAAACTGGAAGCGCTACGTATCGCCGAAGGAAAGTTTGAGGCAGCTCAGGCTCGACTTCAAAGTTCT
GAGGACAAGCTGCAAAAGTGTCAGGACGTGCTGACACGTTTGCAGGAGGATTTCCAGACGCAAATGGCGGAGAAAGCTCGCGTTGAAGCCTTTGCGCAAG
CTACCAAACGCAAAATGGAACAAGCCACAGCACTGATCGGAGGGCTCGGTGGCGAAAAGGAGCGCTGGACAGAAGACTCGAACCGTTTTGTGGAAAGGAA
GCAACACCTCGTGGGAGATTGCGCACTAGCTGCAGCCTTCCTGTGTTACTGTGGCCCATTCAACCGTGAGTATCGTGATTTGTTATTACGTGAGCGCATT
CCGTTTGAGCTTGGTAATTCGCCATCTCTAACACCACcagcgagcaacagcaatgcTAGCCCCACCAAACCTCCGTATATGATCCCTCTCACTCGCGGCT
TGGCACTCGAAGAAtttcttgtcgatgctggTACAGTTAGCGACTGGAAGTTGCAAGGTCTACCATCGGATCCTCTGTCAATCCAAAACGGGATGTTAGT
TGCCAGAGCGCCTCGTTTCCCGCTCTTGATCGATCCACAAGGACAAGCACTGTCGTGGGTTCTACATCGAGAGGCAGAGCGACTGCCTTCTATGGGAGTT
GTGTCCGTAAGCAGTCCGAAACTGCGTGAGATTCTCGAACATTGTGTGGGTGAAGGCAAAGCACTGGTTCTAGACGGTGTGGATGGTGCAGACCCTGATC
CACTCATGGCGAATGTCCTCGATAAGAACTACATCTCGCGTGCCAAGGGAAAATTTGTCAAGATCATGGACCGCGTGTGCGAGTACCACGAAGATTTTGC
TTTGTATCTTACGACTCGTGTGCCAAACCCACACTTCTCACCAGAACTACAAGCACGTACGCTTGTTGTAGATTTCACCGTGACTCAGAGAGGCCTTGAG
GAGCAACTACTGGCTCAAGTGATTCGTCAGGAGCAGCGTTCACTCGAAGAACAGCTTGAACGAGTGCAGTGCGAATTGAACGCGAACGCAAAAGCGCTTG
TGGCTCTGGATGCTCTTTTGCTTGAGCGGTTATCGGCTAGCAAGGCCAATCTCCTTGATGACGTGGAGCTCGTATCTGTATTAGCGAACACAAAAGCTAA
AGCTACCGAGGTTAACGACAAGATTCTGGCGGCCGAAGAAGTGAAACGAGGTATTGATGAAAAGCGCGAGCACTATCGTCCggttgcagctcgtggctCA
GTGCTCTACTTCGGCATCGTAGATTTCGCAGCCGTGAATGCGATGTATCAGACGTCTCTGGATCAATTCCTACAGCTATTCGTTCGTGCTatcgaagaag
cagaacgaTCTGGCCTCGCATCCAAGCGCGTGACGTATATTCTCGAGACTCTGACGTACATTGTTTTTCGTTACGTGAACCGTGGACTCTACGACCGACA
TCGCCTCAGCTTCCTGCTTATGATTGCTCTCAAGATTCTCGTTTCAGCAGACTGTGTAACTCCAGCGGATGTGACTCTCTTCCTTAAGGCTGGTGCATCG
CGCAAACTATCAGGAGACCAACCCAAGCCATTTGGATGGATGCCTATAGGTGCGTGGCTCAATGCTGTACAACTAGCAAGTGAAAAACCGCACTTCCGCA
ATCTTCTAGGAGATCTCGAACGCAGTGAAAGTTTATGGAGGAAGTGGTTCGAGGACAATGAACCTGAACGTCTTGCCGTGCCGGACTACGAGGGTCTCCT
ATTTGACCCTCGGGCAATCACAGCAAACCTTCATTTCCaccggctgctgctggtacgcTCGTTGCGTGAAGACCGCACAATTCCTGCTGTGCACGACTTC
ATTCGGTCTATCGAGTTCATCGAGGGCACAATAGGCGTAAGTTTGCCGAGGTTACCTGCTCTAGGGGCTCGCTATGTTGAACCGATCACAGACACTGTCG
AAAGCGTATACCAGGAAATGCTTGCAGAGACTCCGGTGCTGTATTTGTTATCGCCCGGAGCTGACCCAACCGAGACGATTGAGCAGCTTGCGCGACGAAA
ACGCCAGAGTGTGACCACAATTTCTATGGGCGAGGGACAGGAAGCTGTTGCGGCGCGCACTGTAGCTTCGGCAATGCTGAATGGGGCCTGGGTTCTTCTG
CAAAATTGTCATCTAGGGCTGAACTACATGGATGCGTTGTGCGAAGCACTCACAGCTGCaaatggtggtgctgcaggcaACAACAGTGCAggcgcagctc
cagctcgtgctcCGGAATTCCGATTGTTCTTAACATCGGAACCTCATCCAGATTTCCCCATAGCGCTGCTACATCGAAGCACAAAAGTGACGAACGAACC
ACCTGCCGGTCTTCGCGCCGGTTTACTCCGCAGCTTTACAGTTTTGGTGGATCAAGACAAGTTGGACCGTCTTGAGGCTCCATCCTGGCGCTCTCTTCTC
TTTGCTGTCTGCTTCTTACACGCAGTGGTAGTTGAGCGTCGCAAGTTTGGGCCACTGGGATTCAGCGTGCCGTACGAATTCAACGCCGGTGATATGGGGG
CCTCACTTAGCTTTTTGGAGCGGCATTTGTACatgtcgccatcgccatcgtggCCTACGGTGCAGTACATGGTGGCTGAGGTGCATTACGGCGGACGAAT
CACGGATGAACTAGATCGTAGGCTGTTCCGCGCGTATTGTGACGCATGGTTCAATCCGACACTGCTGGGCAGCTCGTTTTCCTTCAACCCTGAGGTGAAG
CATTCTCCAGGATCGGGGGCCGTCTCCTCTGGTCAATTGTTCAACTACTGTTTACCGGAATCCCCCACAGCGGAGATCGAAGAGTACCAGCGATTCATCG
CAGCGTTTCCGAGTGTTGACTCACCCGAAGTTTTTGGCTTACATCCGAACGCTGACCTCACGTATCGTGTCAAGGAAGTTGCGGCACTTTTGGGCACTAT
CGTGGACACTCAACCTGCTGACGCTGAAGGAGGGTCTGGAGCAACAGCGACATCGAGCAAACCCGAGACAAGAGAAGATATTATTCAGCAGAAAATCCGT
GAACTGCTGGCATCCCTTCCGGCAGGGGGAGAAGAGTCTCTAAGCGAAGAAGCGTTGGCACAAGCATTGCGTACCAAGGTTCTCGGTGGTGGACTCGAGC
TCCCCCTGAATCTATTCTTGTGTCAGGAGGCCCGAGCCCTTCGACATGTTCTCAAGTACGTCCGAGCATCGCTAGTGAAGACGCAGCGTGCGCTGGCTGG
CGAGGTGCTTCTTACATCGTCACTGCGCGAGACAGGCCAGGCCATTTTTGATGGAAAGGTGCCTCCGTCGTGGGTAGCAAACGAACAAGCTTGGCTTGCC
GGCACATTGGGACTCTGGATCACAGGACTTCTCGATCGAGTGACACAGTTACGTGCATGGCTCGACCGCGGTCGGCCATCGAGTTTTTGGCTCGCAGGTT
TCTCCAACCCACAAGGTTTTCTCACCGCAGTGGCCCAAGAATCCACGCGTGCACATGCAAATGAACGCTGGGCGCTAGATGATGTGGTGTACTATAGCGA
GGTAACCGACTACGAGCGACTAGAGCAGATTAAGCAGCCACCGCGCGAAGGTGTCCTCGTACATGGATTGATGCTTGACGGCGCTGCCTGGAACCGGCCG
GATGGGAcgttggtggagcaggagccCAAGCGACTTTTTGCACCGCTGCCTGCAGTCTACGTTACGGCTGCAACGAAAGCCCACAAGAagactcgagcag
cacagGACCACGGACCTTACGGGGCATACGAAGCCCCGGTCTATCGCTACGCTAGACGCACCGACAAGCACTACATTTTCTCGGTACCCCTTGCATCCAG
AGACCATCGACCATTGCATTGGACGCTGCGTGGTGTTGCTTTGCTCTGTTCCACCGACCAATAGGTCATATAGCAGCTAGACGTGAAGCATCTAAACTTT
GAAACATTGGCGCGAGATTGCTTTAGTCGAGCGATGAGACGAAACAATAACGCCCCTAACGGCGATGCGATCGTGGTATCCCCACCAAAATGATGTTTCT
GATGTCAAAGAGCCCCGCCAAATGATGGCGTCGTTCGAAGAGATTGTGCGTCCTCTTGACACTGCGCTAACATTTGACGTGTTCAACACCTCGTCGGCAG
CCACTGCCATCCGCAATGAAGACTACCTGAGTGGAGTATTGTTCGAGTGATCCACAGCACCCAGCAATTCATGGTCTGTGTTCTAAAAAGGAGTCGACTC
GAGCCGTTCAACTGGTGGCCGCTTCAATTATTCCatgctccaccacctcgcaCAGCATAAATAAGCGTCTTGGAAGACCCTGGGGAAGGCTTGCAGCAAT
GCAATGGTGCAGGATCTCATGGTACCTCCGGTGAGCCTTCATCCATTCTCACTTTTCATCCAGCGTTCCTCGACACAGGTCAAACAGAATGGTGTTTTCC
GGAGGGGTACGCTCCTTCGTTCAAGTCGTTGCGGTATGCGCACTTGCTTTAAGTGTATTGCCTTCGATCCAAGCGAAAACCGATAagacgccagctccga
cgcAGTGCGGCATCTCGGACGGTGACAAGAGCGCCGGGATCCAGGTCATCAACGACCACGAGTGTGCAAATGGTGGTCTTGGGTGCTACAATGAGCACTG
TCGTTACTGCAAGGTGCTCGACACCCCCAAGTCGTCGCATCTGCACACGTGTGACTCCTATGGCGTGGCGTTCACGAATACGGCGCCGATAGCCGTCACT
AAAGGCCCCTGTGAAGTGTCGACTGGcgatgtcgctgc