Description :
From Genome Similarity Track
Location :
Scaffold_15:41427- 51036
Transcript NameFunction/comments
Phymu_g1063hypothetical protein PHYSODRAFT_561009
Phymu_g1064hypothetical protein PHYSODRAFT_561013
Phymu_g1065hypothetical protein PHYSODRAFT_505810
Phymu_g1066hypothetical protein PHYSODRAFT_507614
Phymu_g1067hypothetical protein

Sequence
9609 bases(100 bases per row)
CACTGCTGTCTCCCCTCCCACTTTAGCGAATTTAGAGACGTCCGGCACGACGATCAACGTGCCTGTGAAGACAACACGGTCGCCAGCCTTAGCTTGTTCT
ACGTTTTCGTGCCTGAGAATGACATCCATGGATCTGGGCATGCTTCCGGCAGGGATCTCGTCACTGTTTTCCTGTACTTTGACGCGTTGCCAGTCCACAA
ACACCGATTTCTCGGTATTGAGCTCCCACTCGAAGGTATTGGCACAGTACGGGTTCTGGCACTTGGTCGGCTCGCTGTACcggaactgctgctccactCC
GGTGGTGTCTCCGCCACAATCTTCACATGTGAAGGCCCCGAACAGCAACTCTGGGCGCACCTCGGACGTTCTGGTCACAGTTCCTGAAAAAGAAAGCAGT
TCTCCAATACTCCTGGTCCTAAGGTCTCGAATGCTAGTAAATAGAACACAAAACAGATCAGTTAGTCCCCGTTCCTAGATTTTAGACTTTTGGAACGGAA
AAATCGTACTGTGacacgtgctggaagttgtAGAAGTTGACGAAAAACTCTCGCTGCGACTTGTTGGCGTCTTCGTTGACCGTGTAGGCCGCGTCTTCGA
GCCGAATGAACTCAAAGACACTTCGTCTTAAGTACGGTTCCCATCGGTAATACTGGGCCTGCAGGGCCTGTGCCAGGTCCGCATCAAACTCCAGGACGTG
GGAGAAGTCCACAAACAGTGACGAAGTCTCCGTGTTGCGCATCACCTCCGCTTGCTGGCTGTAGTTGATTTTGGCTGGCGCTCCTTCGTCCATCGGCTCG
TCCTGATCGTCCTGCTGCCCGTACCCACATAGaaactgcaggaagcgcGTCTTCACAGCTTCGGCCGTTATGTCCACAACTAGTTCCACTGGCGCAGTGT
TCGGGTTGAGCGTAGGGGCGCCGCTGCGGCCGCGCTTGGCGCCGACGCCCGCCCCACCATTGGCACCTGGAGCCTGCATTTTTTTAGGAGTTTTAAAAGG
AATTTAGAATGAATGTGGTGCACACTAAGTTGTAAGTTTTGGGATGTGTGGTGCACACTAAATTGTAACTTTTGGATTGGAAATGTCTTTAGAATCTGAT
CATTTTCTCTGAACGTTGTCGTCGCACACAAGTATCGTGGTCCGTGATACTTGTGTGAGACGACAACGTTCATAGTTCATGGATACTCAGCTATCTACGC
CTATCTCGCGGTGCATTCTTTTGCAAGCTTCGGAGCAACTACAACTACAACAACACAGAGGGAGAGCTTGGAGTCCTCGAGTCCAGGACACCATTCTGAC
CTCTATTCGCCTGCACCGGCTCCGGTGCCAAAGTGCCGCGACAAGGAACAGAGCTTTTTTTGCGAGCACGACGCGTTCCATCATCTTTGTTCTCGACTCC
CGCACCGTCTGCATTATCATTGAAGCGGACGGGGATTGCAGTGGCCAAAACTGTCGGGCATGACCAGCGCACACATCGGCGTATTTCCCCGTCAATCGTC
CGTAAAGCGCTGGCGACAGTTTCTATAAGCGACTTATCCACTGGAATGTCTACGTCTCATGGTGCGAGACTCGCATTTTTGGTGGCCAAATAAAGTCACC
GCTGCTCTATCCTGCGCGCACGGCACCACCTTCAAATCTGCAAGCTCAAatatcttttttttttgcatAAAGACGtccgctgctgaagccgtCTTGCTTC
TAGCCCCCTTGACGTCCTGGGTAAACGTCGGATCCACCGCAGGCAAGATTTTCTTCAGAGAAACCGGCAGTTCAAAATATTGCCGTGGTCGTCATTCTTC
GGTGGGTGTCAGCTCGGTTCGAACTGCTCGAGTATCCTAGCAACGCAGTGACGGCGGGCATCGCGCGAGCGCCGGCTGGCTCGGTTGACAGGAGCTTATT
CCAGCGTAACCAACGCTTCGGTggtggcaagcagcagctggcgCGACACGAAATTGACTGGAGAAATCAGCGACCGAGCAGCTCTGAGGCCACAATGTGA
CCGGAAACTTGTCACCATGTCACCGTGGTCGCCGTCTCCCAATCCTCCGGATAGCTTGCCGGGTCTCTCGACCGTGTACGCCAGCGAGTCCAGGCGTGCG
AGACGCGCCTCGCCTCAACAGGCTCTCGCTGGCGCATTTTGGCAAGAATGACAAAGGCGCCGGCCGGGGCCCGGGCCGGCTCCACCAGTTTCGGTGCGCC
GGTTCAACTGCGATGACCGAGTTTCTAAACGCTTTCACACTGGGACTTAACCAGTGGCAAGTGGTAAGTTTCCACTGCAAAGTCAAGCTAGCAATCTGCT
ACGTGCGCTTGGTGCAGTGCCTGTCTGTCCTCTCTTTGCATGTCATCCGAGCATGAGTGCGAAGTTCATTGTCGTCGCGGGGTGAAAGTGTCTGCGGCAC
GTTACAGCCCGCACCGCCTCCCAAGCCTGCACTGCACTGCACTTGCATCTGTACAGCCTGTCACCGCTGCTTGCAGCTCGGCGCCTGGAAAGGGGGCGGA
GCCGCATCGATGATACCCACTGCTGTGCGCCGATGCAACAACGACGCACCTTCCACCAGCGCCTGTCCCTCCGTCCCTGACTTCCTCCCGAGTGCCGGAG
CGTGCTATGCACTGCTCGTCGCGCCTGTGATGAGAATGCCAGTCGTCTTGATGCGACCTAAGCGCGCGACCGTCGTCGATCCGGACAGGGAGAGGCAGGA
ACGGGACTCACCCCAACCATTTAAAAATCTGCGCTCCAAGTCGAAAATCaagacacacacacacgcgCTTGGTTTGGAGCTTCAAATCAATTGAACAATg
ggcggcaagaagcgcttcgtgATGAACCCGTTCCCGTCCATGGATCTGTCCGCGGGCGACAAGGTGCAGTTGCAAAAGACTGCCAACGGCTTCCTCGTGG
AATGCCTGCAGTCGTACGAAATGCACCTGAAGGAAGGTGGTCGCGATGTGGACGAGCGACGTTGGAAGCCCTTGAAGACGAGGGACAACCTGCGACTGTA
TCTGGAGCGCGAGGTGCGCACGACAACAGACGGGAACCACTCCATGATGAACGAGGCGTCCGAACAGGCCGGCACGCCCGTGTCACTCTGCATTGGCACG
ATGCAGGGCaacctggacgacgtcgtcttcggcaCAGTGAGCACCACGTCGGAGGACATGTGCTTCAACGCCACGTACGTGGACGATCTTTCTGGTGCCG
CAGTTTTGGCCACAGTTGTGGAGCCTACGATTGAAGAGCCATTGacgacgttggcgttgaagtggcaggagcttgacctgctgctgcattcgaACAAGCG
CGACTTTGTGTTCATGGAGGCCACCGGTTTCACTCACCTGGGCAACGGCGAGCGGGTCGGATACCGGTTGATGTACTCGATCGGCTTCCCGCAGACGCCG
GAGCTGCCGAATCGCGTCCGCGCCAGCGtcaacgtcttcttcctctacCGCCAGGAGCACGACCAATGCGTCGAGATGTACGCGTCGGGCGTCGTTGCCA
ACGGCTCCAGTGTCGAGTCGTTCCTGGTCACGGCGTCGGCTATGAAGTTCTTCACGGCCATGAAGTTCGCGCACTGCGGTGAGATGAAGAAACTCACGTG
GCTCATGCACCGCCGTTACgcgctggacaagcagcgcggCGCCCCCCTTGGCGAAGGCGAGTGCGTTAACTGTGGAATCCCCATCAGTTCCAAGATCTTC
GGCAAGTTCGGCCGGTCGCGGGACTCGTGCAAGCTCTGCCACCGTCTCGTGTGTGGCGCGTGTCGTGTTAAGAAGCGTCTGAACTTCGTTACGCTCGAGa
tgacgttcgaggagcGCAAGACGTCGTTCTGTCCGTTGTGTATCAAGGAGGCGTTCGAGATCAACACAGCAGACGCCGCCCGCGCGCAGATTTCTGGTAA
CACCTCGCAGTACGCTTTCCACTCGGGCACGGACTACTCATTcgcgtcctcctccgactCAGAACGTACCGTGTAAAGGCTTTTTCAAATGACAATTACT
GTTGAACTGTACTATTATAATAGGAAAAGCTTTGGACATGTAGAAGTTAATGCATGTAAAGTTGTTTttgtcttcaacttcaaccgtTTTGaataagttt
ttttttaggaATAGATCGATTGCGATTGGAGAAAAGACACCAAATAATTTAAACGAATCAGATGTTAGGAACTGCTCTCCGACACTGGGGTCCATTACGT
ACGCTGGGTGGGGAACTGGTTCCTCCACGTCCCGCATCGCGTCTTCCGACTCCCACGCAGCAGTTCCCCCCCCCCGGCAATtagcagctccaagcaccAA
CAGTTACGTGTGTCAAGTGTTTCAATTGAAATCGTCACTTGACAGCTTCTTATTCGGGATCTAGATTCTAGATTCTAGAgatatatttttttaaagaTTT
AAAACGATGCCAGCGTGGGGTCCCAGTCCATTCtcgttcgagcagctctcGGTGGAGGACGCGAGCAAACTGGGCGAGATCGCTCGCACTTTCGTGCAGG
ATAATATGCGCAGCTACGAGAAATATCTGTTCGAGGACCAGCGTCGACTGGACGAACGTCGTTGGAAACTGACCAAACAGCGCGACGGGGTGCGCGTGTA
CGTGGAGCAACCACTGAAAGAGCGACGTAAAGTCGGTGGAGCCACtcaggacgagctggagcgggAGTATCGACGGCAATTGCGACGCACAACAGCGAGG
GAGAAGGTGACggctgcagccgctgcatCGTTAGCAGATCTGCCGCTTTTACTGGCGGTGGGGACCATAGCGGgcacgctggacgacgccatgTACGGGG
CGGTGAATTCCACGTTGGACGCGATGAGGATCAAGTCTTCGTATGTAGGGGACAACATGGCGGACGGAGCTGTGTTGGCGACGATTGTGGAGCCATCAGC
GACTGACCCGTTCCATTCTCTAACTGTTAAGTGGATGGAGAACGAACAGCTACAGGTTCTAAAACCCGTGGTGAAGAACCGGGATTTCGTGTATTTAGAG
GTCACAGGGCTCGCCGAGCTGGATACAGGGGAACGCGTGGGGTACCATCTCCTGCACTCGGTTAATTTCCCACAGACGCCCGAGTTGGAAGGCCGAGTAC
GTGCGAATTTATCTGTTGGAGCGCTGTACAGACAGGAGAAAGAAGGTCTCGTGGATGTTTACGTACGAGCCATCTTGAACCCAAGCGGCAGTATTATCCG
ATCGCTTGTGGTGAGATCTGTGGCGGATGCGATCATTTCCGTGACGGAGATCGCTGAGTGTgctcagaagaagaaactggcgtGGCTGGCCAAGACTTCG
CGGGAAACTCGACGCCAGAGGCTCATGCAGAACGCAGTAGctgcggtggtggaggcgaATCGGATCAATTCGCCTGGAGCGCAGTCAAATGGGACCAGCA
CAACGTCCAGCTCAGCTACGACTCGACCTAGTGTTCCTCTTACGGTTATCCACGAGACCCCCGCCCCAGTGACTGGaaactcgatggagaagtgcaCTTC
GTGTCAAAAGCGATCGGTCCATCGAACCCCCAGTGGCAGTTTAGAGAATACGTACGACAAGCGCTTGGATCGCGATCGGTGTAAACTGTGCTACAAGTTC
GTGTGCTCCTCCTGCCGGGTGAAGCACAAACTCACGTTCATCAGACCCCAACGGGAGCTTCTCCGACGTGACTTGCGCTTCTGTGGCCGATGTGTCGACC
GTGCCAGAGCGGCTGACACTTTGACGATTGCTAGCGAGGAGTTGGCGTCCGAAGAAGCGTTTACGGAGTTCTATCGGAGTTTGAGCCCACGTTGAAAAGA
TAGACCCACCCCAGTTGTCGGCTGCTCCTGCATTTAATCTCGAGTCGCGTGAAGATTTTTTCGCGTTTCTGGAAAGCGAAATGGCCGAGAAGGATGCGAT
TCTTGTGGATCACTATGTCTTGAGCAAGGCGATTTTTTTCCGATGAATAACTGTTCAATACCTTTCTCAAAGTGGTTCAAATCACAGTTACCGCGCAATG
GAAACCAGTTTAGGCTTATGGCAGTGATGACTACCTACCAGAAGATTACAATTGTTCGGCCTAGCCAGCCCCAAACACCCCATGCGGAAGCCATTGGAAA
TGATTTTATGCGTAAAGTCTTCACTGGTTTTGCTTCCCATGTTCGCTGCGACGAAATTGCAAGTGCCCGGAGCCCAGATTTTCTCAAAGGTAGTGGAGTC
CGTTTGGTGCGAGGGATCAAGAACtgtgtttcttcttcaaactctGGGAATTTATGGAATGAAGCCGGATTTGTCTCCTGCTGACACgagaggagaacga
gaagttcCATGGGACTTTAATTAACGTATCCTGGGGATTGGCGAATCGCACTGAGTCACTTTTTACGTTGTGAGTAAGGTCATATCTATTGTTTCTGTCG
TCAGCTGCGCACACTCTAGAGATCTAACTGCTATGGACTTCTAGCTGGGGCAGATGATCTCCAGTGTCTTCTGGCACGATCCTGGTTGAACAGCTACCAC
TGCAGGCAGACTCGTGAACGTGAAGGGGTTGTCGCCGACGGTACTCGAAATGTCAAGTTTGTACGAGCCATACGAGCCACGGGTGCGGCACGAGTAGAGC
TCTGGTGGGTAGTCGGCCTTGGTTTTACCAGCTAGTGCATCTTCGGTACTGGCGCCTGTGGGTGCGACAGCTAGAGTGTACGATCCTTTCTTGAGGAACG
TGCTCTTGAACGGGTCGCGGTAGCTGACAGACCCGTCATCGATTCCTGCGTTTTCCTGGCTGTCGTCCACAGCGAAAACTTCGACGGGGTCTCCGTCCGC
AAAGAGATAAATCATCGAGTCCAAGTAGGAAGCGCGACAGTCGCCATTGAGATCGTAAAACGTGTCATTGTCTGCGATTTCGACCGAGAGAACGTCGAAC
GAGACGTCCGTGTCACTGCTCAGCGTGAACTTGACTGAGTCGATGCTAACGTATCCTGACGCGAGGATGATCGCGCCATCTACAGTCAAGCGCGAGGCCA
AGGGAAGAGCGTCCTCCGGTGCTGGGGGAGTGTACGCAGGGAAGTGCACAGCGTTCTCCTTGGGGTCGGAGCCATCGTCAAGACCGTCGAATTGCGCCAC
GTCGATACCGTTCGCCATTAGGTCGGCAATGATACTCTTGGCCGGGATACCGGTGTTGGCACACATTTCACCGCAGTGGTGAAGTGCAATGACGCCGTGG
TCGGCGAAGGAGATAACAGGAGACCCGGAAGACCCACTTTGTGTGTCTCCACTGTACGAGTAGCCAACGGAGCcgcaggagctggcagtCAGGCTCAGCA
ACGCGACGTTGTTGTTATAGTCGTCGACCATCGCCATTCGTTTGCCCTTGTACAGTGGGTGCTGAGGGATGTACACCTGCTCACCGACGACGCCGTCACG
TGCCTTCAGCCTCAAGTATCCGTACGTTTGGGCGATGTCGGCGCCGTTCGTCGGTAGTTTGAGTAGCGCGTagtccagttcttcatcgGCGTGAACGAGA
TCAACGCCGATTGACACGACGTCGCCTGGACACGCACCCCAGAACGCACACGAGACTTTGTCACTGCAGATGTTTGCTTCGGCCATGAACTCCActgtgg
cgctgctggcttcGGCGTCCGTGGAGATGCAGTGGTAATTCGTCATGACGTGGCCCTGGTTGCCAAGCAGCCAAGCCGAGCACCCGGCGGACGCGCCAAA
GCCTTTCGGGATCAACAGTCTTGCGACCGAGCGAGCAGCCAGGAACGCAGTGCGAGTAGTaacgtcgtcgtagtagcAAATGGCCTCCTTCGTGTTGTCA
GCGGCGCAGATGGACTCGTCCGTGGAGGAAATCgggttgtcgtcgtccatgaggaCGTAGTAGTACGAGTCCACCACGAAGCCGTAGCACGTCGACTCCG
TGTCGGTCACGTTGAAGGGCGTTCCACTGAGGTTGCTGCCCGTCTTGGTGAGATTGGAGCTGCCTGCATTACGGTAGAATTCAAGACGGAACTCCTTGGC
AAGAAGAGGCTGAGCAAGGACGTCGTCGTACGTCTGACCACTAGGATAGCTGGTCGAGAGGTTGAGAGTGCGGTCGGGCGAGTCGAAGCCTTCCACTGCT
CGGAGCATCACCGACGCGCCTTGAGGCATCCAGAAGCGACTGAAATGTAGCGCCACGTAGGCGTATCCGGTGCCTTTGGTCAGGGTGAACGACCGGAACG
GTGAGGCGCTTCCTGGCGTTGCGCTGTCGAATGCCGTCTCGAACTCTGGACAGCCCATTCCAATGTTCACGCTTCGCAGTTTGGGTgtcgtggagctcga
gtTGGAGGAGACCGTCCCCGTGTTGTCGATGTAAACTGGCGCCTCTGTTCCATCATCGGTCGAGAAGGGCGAGAAATCGGCGTCCCGTAGATTGTTCTCG
TCTCTCATCTTGGGGGTCACCGCGTACGCCGTCATCAGCATCAACACGATCAAACCGGTTAGCCCCATGGCTCGATGGCGGTTTTGATGGTGATGGTCAT
GGTGGGTGTCCAAAGACTCATCGTCCAAGCGATGATGTGTCGATCCCAAGACATCGTGCATTCCTCAGGCGGTGGTCGAGACGCAGTAGAATGGCAAGTG
AGTTAAGATATTGGGCTTAGGCattgcagcaccaacacgtTCCACGCCTACGATTTGGGATATGAATAGGGGGACAAGATGCTTCGAGGACGATAAAAAT
GCCGTTCACATTATTTTTAATTTCGTAGTTGCAGCGTTTGGACCACGGTTAACGAGCGCAACATATCCCAGATCTAACTTTGAGCTGCATTTTCCTAGTT
ATACTTTCGAACGCTAAAAATGGTCTCCTGTTGTTCGTACTCGATCTTGTTTACTTTTATTTCACCGAAATAGGAATTCAAGTGTTGAAGATAcaatcac
ttcaacttgtagACGGTAGCGTGTCAGCTGTTGATCATTTACGGAGACTCAGATGGATACACGAGCGAGCAGATACATGCACATGTGCTCGCTGTAACGT
TAGGCTACAATCTGTAGCAGCCTGACCTGGAGTGCTGCTCGTGGAAAATTCGTAAAAGTTGACTCGAATGCAGCAGAGCCCTGAAGTTGaacatgtacag
tacctgCATTTGGGCGTCTTGATTCAAGATGCCCAAGACTCTTGATGGAGAGTTGGCCGGAGGGTGAAAGGATGTGGCAGGCCTGGATACATTGACGCTG
ACACTGTCGAACATGGATCCAAAGCAGACGAACGCTCACGCATCCGATAGAAAATATTCATTCGGCCATTCCTCAACTTCCGCTGTTGTGGTCATGGCGT
CGCCTTCGAGTCCGTTCGGCTCTTTGCACGTGTCGTGTACCGACACTTTATGGCTCCAAGAGCTTGTGCGGTTGCTCGTCCACGAGCACATTTTAGGCTA
CGAGAAGTACGTGCACCAGAACCAGCGGATACTGGACCTGCGCCAATGGAAACGACTCACGCAGCGCGACAACCTGCAGGTTTATTCCCAACAACCAGCT
CTGCAACggaagaactgcagcgcaGGCGAGTGcagctcaagacgaagactGTTCAGGTCACGCAGAGAAACGGAGGTGGACACTGCACTGGCGACACTAT
TGCTAGTCG