Description :
From Genome Similarity Track
Location :
Scaffold_18:41424- 43466
Sequence
2042 bases(100 bases per row)
TCGCGCACAAACTGATACTGCGGGGCCAGTAAAAGTCGTGACTTACCGCGAGATAAGTCTTCTCACGCCCACGATGCCCACTAGTTGGTGCATTGTGGCA
CTCATACATGATGCGTAATAGCAAATCATTATGGGTGGGGACGACGAAACGAGGTGTGTTGCCGTTAACGGACGTATAATACAGCAACTCGTTGCGTGTT
GTGTATCGACCCGCGGAAGACCGATACAAGGCCGATAATTTTTTGAGAAATTTACGAGATGGAGTCACCAGATGATCCATTAGTCGCAGAAGAGCCTTAT
CTACTGCATAGAACTTTTTCATGTCGTCAAGCAATGTTGTCGACGGAACACTAGTGACTAGCGTTGCAACAGTTTTATCAACCCCACTGTTGGACTGCGC
AGCCGACTCGAAATCGGGTGGCGCGACAACATTAAGTCGTCCGGGTTTGTACTCCACGGAAAAGTTGTACTCCGCAAAGAAGGACAGCCACCTCGCCATC
CTTTGCGAGAGGTGGGGGCTGTCTACGGCCGTGCGTAATGACGCATGGTCCGTATAGACTACAAACGGGCCTATCTCCAAGGAGATAGACGCGAAACTTC
GCCAGTGTATACTTCATGGCAAAGCGTTTCTTTCCATGCACTCGATAATTACGCTCAGCTGCTTGCAGCTGACGCGATTGATAACAGACGACACGCTGTG
CGCCGTCTGCATCGTACTGCATTAACGCGCAGCCGATTGCAAAATCGCTGGCGTGACAGACCACATGGAATGGTCTGTCTTGGTCTGCAATCGCCGTCTT
GGCGATTGCATCAAGCTCTGCTTGATACCTTAAATGAACGCTGACAATCAGAATTCCATGACCACTTCTCGTTCTTTTTTCAAGAGACGAGAGAGATGAA
CGGTCATCTTGGCGTAGTTGCGCGATTACTTGTGTAAGTACGTCGCTAGACCAAAGAATTTTCTTAGTCTCTTAACGTCGACTAGCACAGGCCGGTCGAT
AATCGTCCTAATTTTTTTAGGATCAGGGCGTACGCCGAGTTTACCCACGATGCACCCAAGAAATGGTATTTCGCTAGCAGCGAATATACACTTCTTGAGG
TTGGATATTTCTGCTCATAAGTGTAAGAACCTGACGAACGTGAGTTCTATGAACCTCTACGTCTGCATTTCCGCCCATAGCCCGTCTATGGACGAATACA
TCGTCGAAGTAACTCGGTGCTAAGTCTCGCACCGGTCTCAACAGATTTGTGACGCATCTATCGACGGTGGCAGAGGCGTTACTAAGCCCTTGTGGCATTA
ATAGCCACTCCCAGAGCATACTGCTCGGGGTGCTTACTGTCGTGTACAGGATGTCCCGTTCACGCATTAGGATCTGATAGAAGCCATCCATCAGATTCAT
GGACGAAAAGATGGTACTCTTTGACATACCATCAATGATTACGTCTTTCTTCGGTATCGGCGTCTGAGTCAGTACCATTGCAGCATCCAACTTGTTGAAT
GCGTGCACTATCCGCCATCCTCCGGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGCGGAAGTTGACTCCCTCACATGACCCGCAGCTAAGCGAT
CGGCAAAGAACTTGTCGATCGCAAGTACTTGCTCACGAGTCAGTGGCCACTGCTTCATGACACAGTACTTCGAGCCCGGTTTGAGCTCGATTTCATGTCG
AGTGCCTTTATCCTTAGGCAATTCGCATGGTACGGATTCAGGGAATGCATCCTTGAATTCGATCAAATCCTTATATAAAGGATTTGCCTGAAGCGACTCC
CAAGATTGAGACGTGTGTCTCTCAATCCAAGTCTTCTCATCGAGGACACTTTCGTCCATTGATGAGCTGCTGATAACTCGTTCGTTCTCTGCAAATATTA
CTGCCTACCGAATGTCGGTCACGTACTCGTCCTCCGTGACGAGTACATAGATCTGCTTGATCTTGCCACTACGCAGATCTCGCAAGAACCGTTTCGGTTC
TAGCGTTGGCAATTGAATGATCTTCGAAGTCAACTTCGGAGG