Description :
From Genome Similarity Track
Location :
Scaffold_20:414229- 421905
Transcript NameFunction/comments
Phyin_T30-4PITG_10648Putative uncharacterized protein
Phyin_T30-4PITG_10649Putative uncharacterized protein
Phyin_T30-4PITG_10650Putative uncharacterized protein
Phyin_T30-4PITG_10651Putative uncharacterized protein
Phyin_T30-4PITG_10652Putative uncharacterized protein

Sequence
7676 bases(100 bases per row)
ACAACTGCGTGGAGATTTACATGAGCTGTGAGCAGCTCCAGATGCGAGCGGCGTGCAGACTACTAGCGCAAGCGGCACGAGCCATGATCGACACGTACTT
CTGCGATGTGTATCGGAGCGAGAGCTTCAAGAACTTGTCGCTACACGCCGTGATGAAGATCCTGCGGCCGAAGGAGAGAAACAACAGCACAGCGGTGAAG
AGCTGGATGATGCGTCATCCCATAGCGAAACAAAGACAATTGTCGGAAGTGCTACAGCTACCGACCAATACAGAGGACGAGACAGCACCGAAGCGACGGA
ATAGTGGCAACGCTATGGTCAACAGCAAGGAGAGACGGCCGTCGGTGTCGACTGATGATGCGATGGACGTGTACACTGCCAATGTCTTATCGCGGGAGAT
TGAAGAGAACGCCAAGCGTCAGTTGACCCCGACTGTGTTCGTCATTGGAGGGTTCAACAGCCCTGGAGCGCTCAATTCCGTCGAGTATCTGGACTTCCAT
CGTCGTGAATGGCACCCAGCAGCGTCCATGGCCACAAGACGCTCGTACGGTGGCGTCGCAGTCTCGAGTGACCACAAGATATTCGTCATGGGAGGTACTA
GCAGCAGCTCCCATCATCATAAAACTATGGAGGTGTATGACCCTGAGGCCAACACTTGGACGTCGATGCCTGCGATGAAGAATGCACGCAGCTACCTTGG
AGCAACAATGGTGGGGGATTTTATCTACGCCGTTGGCGGATTTAACGGCCAGACACATCTGTCGTCTGTGGAGCGGTTCGATATCCAGACGCAGCACTGG
GAGAGTATGCCTTCTCTCTCAACAGGGCGCAGCGGACTGGCCGTCGCTGCTCTGAACGGACTAGTGTACGCTATTGGCGGGTATGACGGTAGAAAACACT
TAAAGAGCGTGGAAGTGTTCGATCCGCAGACCAACGAATGGTCCACGATCGCGAGCATGCGCTATGCTCGCAATGGTCCAGCGGCGGTTGTGCAGGAACG
CTGCAATAGTATTCTGGTCTATGGAGGGGAATCGCGTCATGGGTCGAGAATGAACACAAGCGACCGACTGGACTTGGATAGCGGCGTATGGAGTGACGCC
GACGCGTTTGCCGACTGTCGTAGTGGCCATGTGGCGTCTAGTTTTCTCAACGAGTCGTTCGTCTTCTGCTTGGGGGGTTCCAACAAGAAAGACGAGTACC
TGGATGCTGTGCATCGCTTTGACAACTTGTCCAAGCAGTGGACGCTCCACTCGCAGATGCGAGCGCAGCGTTGCGGACTGAGTGTTGCAGTTGTCAAGAC
CTCGCGTTATGCCGAGTGCTTTGCAGTACAGAAGCAACGAGAGCAGCAACTGGACAGCACGTCGTCGTCTTTGTGGCGGAAGAGCTGTGAGGGAAACACC
TTCGCACAGGGAGCGTAACGAGAAGATGACGAAGAGAGCCACTTATTTTATATATTAATACGTGTACTTTTACAACTTGAAAGCAGGAAAAGAGCGTCAA
AGTCTTAGCTTCAATGAGGTTTTATTACTTGTTGCGTATCGTCGTCATCCTCCATACAAAAACGAGAGCCTCATTGCATCCTTTTAGACGGAACCACCGT
AAGCGGATAGCAGCGCGTCTCCGTGGAATTGGCGCCAGCCAGCCACCAGGTCTTCGTACTCCTTCGGGTGGTTGCGGTTGAACGCAACGGGGTCCTGATA
GGTGAATAATGAACATAAAAATAACGTTAAATACATGGCCTGACATAATAAAAACGCCACCACGGGTTTTACCTCAGCAAAGCACACGAAAATGGTGTGG
AGAGCCGCAATGATCACGTGGGCCAAGATTAAGGCCATGCTCAGTCCAACCATGAAGCCAATTAGAGCCATCGTGCCGTAGACGCCCATGCGGGAGCCCA
AAGCAGTGAACCACTCGACAGGCGAGAAGCGGACCATCAGCATTCCAACGCAACAGGTGACGATCCCCACTCCCAAAGCCCCAAAGGAGAGAGCGCTCGA
CGTCAAATCATCGTTAATCACCGCTGTCCATCCGCGATTATTAAATAAATCCATCACAGCCTTGCCACTCGTACGGAACGGATAGCCATACACACCGACG
TAGACATACGCCCAGTGGTTTATGTACTCCACGATGTTCGCCAAGCAGCCCAAGATACATTTCGCCATACAGGCCAGACAGGCGAGTCCCCCATTGTTCT
CTTCACTGGCACGACGCTTCGCCATGTCTGCCATCGTCCTCAGAGCCTGGAGAACTGCCACAATTAACGAGCCGAAGCAAATGGAGCCGAAACTCGTCGT
CACGGAGCGGTAGAGCGCTCCGACCGTCGCCTTCTGAGCGTTAGGCTGGTACCACCACGTGGCTACGACGCCTGCTGTCGTGCAGGTCAGGATATTCTGC
AGCACTTGTTGGCCCCAGTATACGCTCACCAGCATGTAGAACAGAGCCGCATAAGCTGGTAGACCGACACAGAGCCCGCCATGGCTACGTCCGCGACTGG
CGAGATCGATCTCCCGGTCACAATCCGGATCGGCCTCAACGAAAACCTTGTGCATGCCTAAGCTTGCGACGCCCCACAGAAGCATCCAGACAAGTTGCTG
CAGCACAAGCACAAACGCCACGACGAACACAGCCGAATGTTGCTGTAAGGCTGCACACGCTGCCTTTAAATTGGCTGATGCAAAGCCGATACGGTTCTGG
ACTGCGTAGATGTACCACACGTTGATAGCGGCCATGACCAGGAAGAACAGCGCTGCCCACACGTTGACCGAGAAGGTGGAGACGGCGAAGGCCAGCACCA
TGCCTACATTGAGCCATAGGGCGACCCTAATCATGGAGGACGCGTAGGACATGAGCAGCTTAATCCAGGCTAGAGATAGCACAGTGCCGACCACGCAGAG
TATACCAATCATCGTCCACGCTACGGAGTGTCCTTGAGGGATACGACCATCACTCCTGTTCCTACCCATGTCTTCTTTTAAGGCTGGTACTCCTTTCCAG
AAGGCCAAAATGCCTAAAACGAGGACGTTGGAGAGGAACATGACGGCAAAGAAAGCGTCATTGCACTTGGCGGCAGGAGATTCGAGACGCAGACTGTTGA
CGGCGCTGGAGGGCGGCGACCGTCGATCTTTGCCGCCGCTCGGGCTCATGAGCATCGGATCGCTCTCGCTCACAGGCGTGTACATGGCTTCAGAGTCCGA
GTCGGAGTCGGAAGTGACAGCGGGGGCAGAGGCGGCGTACGTCTTGGCGAATGTTTGAGTGAGTACACTCACGAACTTGGCGAGTTTTTTCGATTGGCGG
AAGCTTTTTTCTGTGAAGAATCTTCAGATGGTGTTGGAGAACTTGGTGTGGTGTACATGGAATTAACAAACGCAATCCGATTGGCTATTTATCGACTGAC
TCATCAGCTGAAGAGGATGGCGGATGCGGCTGTAGTGGCTAGTGATGCGGCGGCCGAAAGGCCTCTGGGGCCGACGAAAGGTGCGTCGGAGGGTCTTGAC
AGTGTATCGACATAGCTGCGAAACTTTTTAGCTGCTTTTTGCTGTGAAGACTGAGATATTCTTTCGTGTGTGTTGTAGTAACCCTGCAGTTCGTGGCAGT
GGGCAGTGCGCCGCTCATGAAGCGCACCAAGTTCACTGTCATCGGGCACGACCAGCTCAGTGTCGTCTATAAGTTTCTAAGAAAGCAGCTTCGCCTTAAA
GACAGCGAGTCATTGGTAGTACTGCAGAATCATTGACCTATTTTTTTATCTTCTCTCATTGATGTTTGCAGTTTGTGTATTGCAACAGCTCGTTCGCGCC
TTCTCCGGATCAGAGACTGAGCTCATTGTTCGAGGTGCTAGAAGCTAGCGTTACAACTAATTAACTCCGACCTTCTAGCTGACTAATATTGTGCTGGACG
ATAGAGTTTTCAAGTGGGCGACGTCCTGGTGCTCAACTACAGTCTCACGCAAGCGTGGGGGTAGCGATTAATATTAAAGTTAAAAAAGAAATGTGAAGCA
AAGTGCGGAGCAGCTATGTCAATACACTAGACTGACCCAACCAGAGCTTCGACCTCTGCACGTGACGCTTCGTGACGTTGTTGCAGCAGTCGCAGCTCGG
CGCTAAGCTCGTCGTCTCGAGTCATCATCCAGTACAACATTGGGGTTCTTTGGCTTGGACATCTGACTGCGTTGAGCTCTGGCCTTGACTGTAGGAAGCT
CCCCTTCTGCAGAGTCCGATCTCTGGGACAGTCGAGGTTTCGGAACGCGTTTAGCGAACGCCAGTCCCTTTTCCCGACTCGACCTGGGCTTAGCGTTGGC
TAGCTGCTCTTTAGTCGCATCTACTGGTTTCTTTGACTGCGTGTTTTTGTTAATGGTCCGTAGATTCTGGGAGAATGCTTTGATACGATCATTCTTCGCG
CGCTTCTCCACCAATTCGTCAGTGTTCAGGTCGGGCTGAAGCTTTCCCAGTTCGTAGTACCCGTCTGGTTTCTCTTTCTTGTATTGCGCTAGCTTACAAG
GTTCGTACTGCACGGTACGAGCCTTGCGACTGAAGGCAAGTTGGTCTTGCTCTGTGACAACTCGACTTTCGTTGATTTCTCGTGGAGATCGACATTCTTT
TGGAGAGTTTTGCGCTAAGGAGCTCTGTCGATTACGGTCAGGTAAACTAATACTCAGAGCTTGGCGTGAAGGCTGGGCATCCGTGTAATCATCCCGAACG
CGACCTGGCACTCCGGTTGGCTCGTAGGATTCGTAGTCTGCTACCCCGCGAGTACTTTTGGATTGACACTTATTTGCTTTCCCCCTTGGAGACACTACTG
CGGACTCTTGAGGGGGATTCCTTACGGGGGAACGCTGAGTTTGAGCTGGGGGTGAAGGACTAACAGCAGCTCGACCTAGATCAGTCGTACGAACTTGTAT
CTTCGCTGGCTGGCGCAGCATGGTCTGACCGTCGTACGGGCTGTTGTTGTTTTCAACCGGACGCTGCTGCGAGGATTTTTGCTGTTGTTGTGGAGGTCTG
CGCTTGGGGGGGCCGACTCGAATCTCCTCACTCCCGTCTGCTTTCTTGAGATGCCCTTGTGCTGTGACGGTAGCATTTTTCCCCTGGAATCGGTCCAGGA
AGCTCATATCTCTGTGTTGAGAAGAAGAGTCAGCGATGAATGAAAAGCACGCACAAATAGCGCACTATTTCAGCACTAAACCCCCATTCCATTGAAAAAT
ACTGAGAAGCAAAATTACAGACTGCTTTGGCAAGGCTTTAAAAAATGAGAGCTTGAAAGCGCGACCTACAAGTACGTTTTTCTGGATAAAATCCGAATAA
ATGATATTTGCCTGCAACTTTGCCGCATCGTATTAAATATGATGCGGCAAAGTTGCGAGCAAAGCTTATGTTGCTTCAAAGATTTTTTTTTCCATTGAAA
ATAAGCTGGGTTTATAATCGGTGCCTCTCCTGCTGCTCTGATCTCTGCATATGAGACTCGACAATACAGCACTCATTAACCTTCCGTCGCGAACTCCATG
CCCCCCAACGGCGCGAACCAAAAGGTTTTGTCGCCGAAGAACTTGCCTCTGAACCCTCCGTCGATGTGGTTATCGTGGATTCAACAGAACACCCCCACAC
GCCGCGTCTTGCTACTAGGAACTGTCCTTTACGCTTGCGTCATGCTTATATGGTCGGCTTACAGTATTCAGAGTACAGTATTCACATCACGACTTGATGG
CTCGTCAATCGACGACGAACTGCAAGTTCCCTCGTCGATATTTCAGAACAAGGATCGTCTGATCAAAGACCTCCCACCTGGAGGTACGAGGCCACGGCGT
TTAAAGTGTATTGCATGGAGATCCACACGTGGATGCTCGCCCAATGGGCCGAGACAACCGGAGAAAGACCAAAACTGCACGCAGATTATCTCTAAAGGAG
AGAGCGGGTATTGCGAGGTGGAAGATGTGAGTTCGGGTGAGAACTTTCGAGTCATGCAAAAATATTGCAACAGTTTGATACATGCAGTACCGTTCCGCTG
TGAAGACGCACAGAAATTCGTGTATTTTCGCGTGGAAGCTGAAAATGCCGCGCAAGAAGCGCTCAAGCCCAGTTTTAAATTGCCAAATGTGATTCAGAGC
CAGGAAACCGCACGTGATGGTATTGTAATGGTGGTGTGTTAAAAACTCCATGCTAGTGCGTACGCTACCATTCGAGTGCTGCGTAGTGTGCTGCATTGTC
ATTTGCCTGTTGAGATTTGGTATCGTCCAGACGAGATGAACAATATTACAATTTTAGAACCATTAAGACGTTTGGCTAGATTAGAAGACAACATCACGTT
CCAAGAGATCACAGATCCGCGGGCTAAACGGTTCGTGGCCAAAATCCACGCGATCTACTACAGTTCTTTCGACCGCGTGCTGTTTCTTGATTCCGACAAC
GTTCCCGTGCGCGATTCGAGCTTCTTGTTTACGTCTCCAGAGTTCGTAAAGTCTGGCGCAATATTCTGGCCGGATTTCTGGCATCCAGACTCGACCATCT
TTGGATTAAATGAGAATTCTCTTCTGTGGGAGCTGATGGATATGCCGTTTGTCGACATGTTCGAACAGGAAAGTGGCCAGTTAGTGGTGGACCGAAGGAG
CTCCATTGGCGCTCGTGCGCTTTTACGCGCTTCATCGGCCGAGCTTTTTCTCGTCGCTGAGACTTTTGTGGGGGGATAAGGATCTCTTCCGCCTCGCGTG
GCTGAAACTAGAGATCCCCTTCACAATGATCCAGACGCCTCCTGCTATGGCTGGCATCATCTACGGTTTCTTGCTGCGCTCCGATTTTTGTGGCTTGACG
ATGGTGCAACATGATGCCGATGGAGGAATTCTCTTTATGCATCGGAATCAACACAAACTTACGGGTAAAAGTACAGAAAAGGCAGTCGACACAAGTAGAA
TTGAAGATGATCCTGAGGAGAATTATGCAGACCCAGCGATATGGACACATATCTTACGCTTCCGATTGGAAGCTAGTCGGAGGAACTACGCGATTCAGAT
GCTCCGACTTGATTTGGACTTTGAGGCCAACAAAAAGTGCTTTGGGCGGCGAGATGTGTATCGAAGCCCTAACTTTTACGTCCAAGAGATCACTACTTTT
AGCTTTTCTGGGCTAGAAACTCTACTGCGGCGGTTTGCATTGGAGTCAACTCGATTCTCCTCAGGAATATGAGCCACGATAGCATAAAATGGGACAAATA
CGTGCAATACGTGCAGTTGCTTTATTTTCTCTCCAATGCTAAATTAGGACTGTATTAATAGACAGTACTGTACATCCGGACTCTGCTCGCTGCACTTTTA
ATTTGGCAGTCCCGTTTGCGTGTACTAGTACACTTTTAAGCTGCAGCTTCCTTTATCGCGGCTGCGCTGTCTCAAAGTGAAGACGATGTCCCTACATCAT
CACAATTGCTTCGAGTGTCCCAATTTGCGCCAGAATTCGTTTGCCGTACGGTAATCACAAAAGTACTGACATCAAAAATTGTACACGTACGAGTGCATAC
CCAACGGGAGGGGCCATTGTTTTTCAAAGATGCATATGTTCTACTGCATCCGAAATTTTAGAGCACATGAAGAGCAACAGACATAAGCTCAGCATTGACG
ACAAGGACCGAGTTTTACCGCCAAGGCCGTTAAAATATCTATTCTATGAGTTTGGCAGTGTTTAAAAAATCTTTTA