Description :
From Genome Similarity Track
Location :
Scaffold_127:4142- 8583
Sequence
4441 bases(100 bases per row)
AAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGGGAGGTCGAGATGGCCATGGGATTGGCCCTGC
TCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAGCGTGCGGCACGTCTGTTGACGCTGCATT
TCTCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCCAATCAGGCGTACCGTATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGT
AAAAAGGGTTTATTGGACTACGTCCAAGAGTTGAGACCTCTTATCGCCGGAATGGCGGCGAACTCTCTTCCTGAACTGGTCAGCGTGGCCGTGTTCATGG
AGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTCGAAGAGGCGGTGGATGTGGCATTGAATGCCGAGCACAACTT
CAGGTCGCGCCGACCTGGTTGGAGCGCTGGTAGCGCAAACTCTTCGAGCAGTCCAGAGCGGATGGATCTCACCTATGCTGAAGATGAAGAAGCGGAGCTT
CTCGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCATATTGTCCTCTGCGTAAGAAGCGCGAGGCTC
CGGCGAGCCAAACCTCCGGGTCATCGCCGGAAAACGGCAGCTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGA
GAGGGCAACGAGGCTCAGCCCCGAAGAGAGCTGATCTCTCTTACGAAAAGAGTGTGTGCAAGCCGGGTTTGCTGGTCGTTCAAGGGAACGTGAAGAGCTT
TACAAAGCCATGGAGAGTCTTAATTGACTCGGGAGCCTCGGGCAACTTCGCCCGTCGCCCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTAGAA
GTGCTAGCGAGAGATACGATTTCTGTCCGTCTCGCGACGGGGGCACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCG
ATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGTCATGAGCCATGGATCGACTGGAA
GTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCAC
GAGGCCGAGGCGGCCGTAGTGCTGGACATTGATATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATC
CGCGGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACAAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGA
TGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTG
TGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACG
GAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGTAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGC
GTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTT
GATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCGAAGCCTTAAAGGCACCGAGGTGGTCTTGCTGGGACC
TGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGAT
CCTTCGGATCCCTTCTACCCGGTGGTGAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN