Description :
From Genome Similarity Track
Location :
Scaffold_242:41417- 46413
Transcript NameFunction/comments
Hyaar_Emoy2813096hypothetical protein
Hyaar_Emoy28130976,7-dimethyl-8-ribityllumazine synthase

Sequence
4996 bases(100 bases per row)
CTCGATCGACCTCGCTTTTAACAACAACAACGACACACTGAAGCTGACACGTCAACTTTTTGATGAAATTCTTACCAATGTGTAAATGTACATACCCTAC
CAAATTGTCACTTTCCAACAACTCTTTGACGCCTATGCAAAGCAGGTAGTTGTTGACAAGTGCACGATAAAGGTCGAGCGTTTGGCTCGATAATTAAAGC
AGACATTGCTGATAACTTCGTGCACGGGCTGGTCTAGCTTTTCAAGTCCAACGCTGTATTGCAAAAGCACTTGAATTAACAATCGATGAGGTGCGAGAAG
AACGGTGGGCTATACTGTTCCTACATAAACCCACTTTATTGTTTCGAGGAAAGAGTAACTAACCATGCATGCAAGGCTACAGATTAACGCTAGGCTATGT
CGTGTAAAATCACGACGACGACTTTCTACCACCAAAAGATTATACGGGATATGTTTCGTTGTTGTATTCCATTTATGTATGGCGAATATCGACGAATGAC
ATTCGCTGATTCGATTGACAAAGAAAGACATCCAGACAGACAGACTCTAGGAGCCAAGTCAATTTGTGAAGCCAAGTCACGAACCTCGCAATCGCATTTG
GGCTCCCTGTTCATGGTGGCCCCGGGAGCAAAGAGGCCGCTTCGGCCAACCNNNNNNNNNNTGTGGTGGATTCTACACTGCATGATCTTGTGAGAACACG
ATCCGTAATGTCACTAAATTGACAGCCAAAATCGATGGACTACCATAGACAATATCGATCAAATTGGTCATTACTTGCACACTTGACTAATGAAACCTAT
ATAGAAGGGGTAGAAACATGCTGGAGTTGTACAACTTACAGGCATGCTCAAGAGAAACATGATACACTACACGTATTGTACACAAGATTGGTTCTTCTCC
AAAGAATAAGGTTTAATTACACGCCAGCGTTTTGCCTCTTGAGGTCGTACTGCACTGAATTGCACCACAGCTAAATCTATACCTTCTATTTATCAATCTA
TTTTGACATCGGTCTTGAAAGAGGCGGGTGTTCAATCGAACTTTGTAGGTTGACATCATCGGTTCAGCAATAGCGGAGAATCTAGTGAGCGTACAATATG
ATTATCACCATTAAGTTTTGGCTCAGGAAAATTGGATTCTTAGAAACGCCACAATCGATAATGGCACGAATAGAAAATGCCACAATCGATAACGACACGA
ATAGAAACGCCACAATTATTACATAACCCTCTATCGCTAATTAGAGTTCACGCTCTCTCCTGACTATTCCAGTTGCGAGTGTAGCCATGTTCGAATCCGG
CTTGACACGCGATGGACAAGTTCTCGTACCCCGAGTACTACGACTTCCCGCCCTTCTTCACTCTCCAGCCCGTGCGTGCGACACGAGAGAAGCAGCTCGT
GTTGTGGCAGCAGCTCGTGCTCGAGTATCACCGCGCCCATGACGTCCCCCTGTTCCAGCCCTTCACGTCGACGCTCTTTGAGAACGTCAAGATCTCCCGC
AGTTTGACGCAGGAGGGACGAGTGGCGGTGATGGAGCATTTGATTCGCTGTGGGCATGGCCAATGGGAAGACGAGACGAAGACGCGGTGCCGCCTCATGT
GGAAAAAACCGGCCGAGTGGGCGGCGGAGGTTTATGACTTTGTAGGGGTTTATTGGTTGATGTTATTCGTTGAAAGAGGTTTCTTAAATAATGCGATATG
CTTGCTAACTTTTTGTGGTCATCTAAAAATGGTGTGTACTGGTGTAATGGGTTCAGGCAAAGACACACGAGATGCTCGGCAATGTGTTTACAGTGTACGA
ACTGTATGCAGGAGACGAGACCTTGGGCACGAGTACGTGGATTTTTTTGCAAAGTTGTAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGCGGGAGATCTTGACGTTCTCAAAGA
GCGTCGACGTGAAGGGCTGGAACAGGGGGACGTCATGGGCGCGGTGATACTCGAGCACGAGCTGCTGCCACAACACGAGCTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTGTAGAATGAGAGAAGAAGTTACTATGGTCATGGTGTGTGGTGATAATTGGTATTTGGTGTATGT
CATGTGTGGTGAATTTAGGTATCCACGGGATGGAGCCGTGGCTGCTTCGTGAGGCTCTGAAAGTGCTGGAAGGCGAGGGAAAGGTGTGTGGATACATTGC
TTTTTCTTTGCTTTTCTGTTGTTGTTGTTGTTCTAGGTGTATTTACTCAGATGGGGATATTATATGATTTGATGCTGTGGTTTGTCGATTTTTGGTGGTG
GTGATGTGCTGTGTAGGCAGCGGTGATTGCTGGTGAAACGTGTGAAGAGGATGGTGTCAAGTTTCTGGCTACGGAATGAAGAAAGCAGAGCAGTTAGATG
ATGGGGAAGGAGGTTCTGCAGGTAATGGAATGGATGTCGTGTAAGGGTAATATGAAGCGATGGGAAGTTTTTTTACATCAAGTGCATGTCATGTCAAAAA
CCGGCGGTTGCCGCGGAGAAGATTATCTGCGTTCCTATTCGCAGCATTGAGACACGCTGGTGCTTACTGCAACTAACGGTAACGTCTACAGGGTAAGGAA
AAGAAAAAAGCTGGTACGTGGACGAACGCTGGTATCCACGTCGTTGTTATTGCACTTCGACGAAGAACATCTCATCCGATGAGCTGGTCAATAGGATGTG
CGGTCTATCTTAACTGCCATGTTGCAGAGTTGAGGAAAGCGACGGAAAGGAATGATTCGTGTTTGACGGTTGCTGGATGTTACCCTTCTTTTCTCGCTCT
CTTCGCAGCAACGGTTAAAATGACGAGCGCCACGTCGCAACAAACATGAGCTTGAGAGGTGCTTCGAACGGAGCTTATTAATGAAAAGATGATGTCTGGC
TTTGAGAAGCTTGCGGAGAAGATGAAGTTGACGTCGAAGGACAACCCTGACGATGGCCATGGCCGTCAATCCGGGGAGCATGACGGAGATGGTAGCAGTC
ATGAGCACCGCGGAGAAAGTGGCAGTCACTATCACCATGGGGGCGGTAGCAGTCATGAGCACCAAGGAGGAGGTAGCAGTCATGAGCACCAAGGAGGAGG
TAGCAGTCACGAGCACCACGGAGGTGGCAGCAGTCATGAACACCACGGAGACGATAGCAGTCATAAGCACCGCGGAGGAGGCAGCAGTCATGAGCACCGA
GGAGGAGGCGGAAGTCAGGAGCACCAAGGGGAAGGTAGCAGTCATGAGCACCACGAAGAAGGCGGCAGTCATAAACACCACGGAAAGGGTGGCAGCCGTG
AGCATCATGCTGGTCACGTGCCAGCCTGCCCGGTGCTGATCGAGCGATCCGGCGCCTCCCGAACTAGCAAATTTGAAGGCAAGCCTTTTCGAGTCACTAT
CGTCGCAAGCCACTGGTACGAGAAGGTGGTCCACTCGCTTGTGGATGCGTGTTCGAAGGAGCTCTTAGCCAAAGGTGTGACGGAAGATAACTTGCACGTC
GTGGAGGTCGCAGGTGCATTTGAGTTGCCGTTCACGGCTGCTCGATTGATTGCGTCCGAGAAGATGAGCCACCGTCCAGATGCTGTCATCTGCATTGGCT
GCTTTGTCGAGGATGCCACGCACACGTGCGAGACCATGCGACAAGCCGTAGCATACGGAATTATGAAGCTGAACGTGACGTCGGACGTCCCCGTCATTTT
CGGCGTTCTCTGTTGCGACAACGAGTCGCAAGCTCACTCGTCCGTGGAAAAGCGTTCGTGTTATGGCATTGATGACAGCGAACAGTGCAACTTCGGTGTA
TCGTGGGCGCAGTCAGCATTGCAAATGGCGCATCTGAGTCGCTGTACTTCGGTGAAGGAGATGGAGCATTGCAGCTGCTTTCGCAGTGATAGCCATAGTG
GTGGTGACAGTGACGAGCACAAGCGGAAGCCTACAAAGCATGAATCTGGAAAGCACGAATCTGGTAAGCATGAGTCTGGAAAGCTTGAGAAGTGTACGTC
TTGCGGTTTGTCGGAGAAGAAGTGCTCGTGCAAAGAGTGCGTGTGTAAGGTGTGCTGCAATCACGGTGGGGCGTGCACGAGCTGCAAGTCGTCGGCGGAG
AATTGCGAGTGTAAGGACTGCAAGTGCCGTTCATGCTGCGTCAGACGCGACGCGTGTCGCCGGTGTGGATGTCCTCCAGACAGCTGCTCCTGCCAAGGCT
GTGACTGTGCTGTCTGCAGCGGCAAAGACGGCAGCGATGCGAAGACGAAGTCAAGCAAGCACACTGATGAGCACACTGATGAGCATGAGTCGACGA