Description :
From Genome Similarity Track
Location :
Scaffold_47:41415- 42416
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013063Similar to FH6: Formin-like protein 6 (Oryza sativa subsp. japonica)

Sequence
1001 bases(100 bases per row)
GCTGCCGCCAAAGAAATTGATCCGCAAGCGACTCCATTGGCAACCCAAAGTCAACCTCGTGCCTACTTCAGCACCATGTATATGGAAAAGCAGCCCCGAT
ACAGTCCAGATCTCCAAGGAGAGCGCCAAGCTGATGGACGCCTTGTTCGAGAAACCCGTCGTCGAGCAACCAGCGAACCAACGTGAGATCTCGGACTCAA
AGCTCAGGAAAACTACCAGGTTCATCGCATTGATCGAGTCGAAGAAGGCGCAAAACGTCGCGATCACGCTCGCGCGCGTGCCGCTGAGCTTCCCAGCACT
CGTCAAAGAGCTCGTGAACATGAACCCGAGCGTGCTCAGCTCGGCGCAATTGCAGTCGCTTCTCGACATGTGGCCCGACCAGAACGAGTGGAAGGCAATT
CGCGAGTACACAGGCGACATCACGCGGCTTGGCACGGTATCACCTACTGCTTCAATTCGTTTGCTTGTGTATTGTGCTGTTGACATCAGCTTTTTGTCCT
TTCAACAGGCCGAGCAGTTCTTCGTGCACGCGGGTCAAGTCCCTCGTTTTCGTGACAAGGTGACGTGTCTGATTTTCAAACAAGAGTTCCCAGCGCGCGT
GTTTGAGTTGCGGTACGAGTTTTTTTGGTTGTGTGGACTTCCTCTGCTGCTTCTTATGCGTCTTGAATTTCTGTTTGTTTTGCGCGGTCGTAGTGAAGCA
GCGACACTGTTGATCCGTGGCACCAACCAAGTGTGTTCGAGCGCCGCACTCCAACGAATGTTTCAGTACATCCTGAAAAGCGGCAATCTGCTCAATATCC
GCGCAAGCAGCACCGACGCTGCGAGTACAAACGTGCACGGTTTTGGACTGAGTTCACTTGCGAAACTCGCACAAACCAAAGCGTTCGTCGGTGGCATCAC
GTTTGCGCAGTACCTGGTGCAGTGCATCGAGGTTCGTGGCCTCTTGTGTTCCGGATGAATGCGAGGTCTTGAGGCTAACTCAATTCGTTGCTCTCCATCG
A