Description :
From Genome Similarity Track
Location :
Scaffold_38:41410- 42439
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13141hypothetical protein

Sequence
1029 bases(100 bases per row)
TGCAAAGGAGTTCGTCCAGTATCTTGCCTATAACAAGAAGACCGACGACCTCCATCAGGGTTAAGACGTACCGTCCTGGATCTACCATACGGGGTAGTCG
CCGTGCTTGTAATCTTTTTTGGGGTAATCTCCCTTGGGGTAGTCACCGTGCTTGTAGTCGCCCTTCGGGTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTAGTCACCGTGCTTGTAGTCGCCCTTCGGGTAGTTGCCGCGGTTGTAGTCTCCCTTCGG
GTAGTCACCGTGCTTGTAGTCGCCCTTCGGGTAGTTGCCGCGGTTGTAGTCTCCCTTCGGGTAGTTTCCATGCTTATTGTCTCCCTTGAGGTAGTCGCCG
CGGTTGTAGTCGCCCTTCGGGTAGTCACCGTGCTTGTAGTCACCCCTGGGGTAGTTTCCATACTTATTGTCTCCCTTGAGGTAGTCGCCACGGTTGTAGT
CTCCGTTGGGGTAGTCACCGTGCTTGTAGTCGCCCTTCGGGTAGTTGCCGCGGTTGTAGTCTCCCTTCGGGTAGTTTCCATGCCTATTGTCTCCCTTGGG
GTAGTCGCCGTGCTTGGAATCTTTCTTGTGGTATCCTCCGCTGGGGTAGACCCTCGGATCTGTGCTCGCACTCGGAGCCTCGGTCTCCTTTTCCGGGTAG
GCACAGCCCCACGTATCGTCCGAGACAAGGACACACTGAGCAACCTTGGGGGCAACGCACTTGCCGTGCTTGTACGATGCAACTCCTTCCCTGCAGCCGC
CGCTGGCTTCGTCACCCTTCAGAGGACAA