Description :
From Genome Similarity Track
Location :
Scaffold_4:414063- 418848
Transcript NameFunction/comments
Phyin_T30-4PITG_03082Outer Dynein Arm Light Chain 1
Phyin_T30-4PITG_03083Nuclease
Phyin_T30-4PITG_03084Nuclease C1

Sequence
4785 bases(100 bases per row)
CAGTCAGGACGGAATTTTGAAAAGAAGTCGATCGCAGGGACAAGTAATTTCCCCGAACTCAATGACCCTAGTGGTGAGAATATAGGTTGGAGATGAAGAA
CTGATCTAATCACTTACTTGTCTTTGTCTGTAGCTCGCAAGCCAGTTCTGCGGACACCAGGAATTCACGAGCGGAAGACAAGTTCGCGCTCTTACTCTCA
AAATGTATGGACAAAGCAAACACTACCTGAAGAGCCATCACGACCAGTAAGCTCCCAAGCTCCAGTCAAGAGCTCCATTTTCACTGCACCAGGGGCAAAT
CGAGCAGTGTCTGCTCAACCACAGTACTCAATACCTGTGGGAATAGTGTCACCATCCAGTCGAAGGCGACATGCTCTACCTCCACATCAGCAGCTTTATC
ACCAACGGAGACCCACAACTGACTCGGTGAGGATGCCAACGGATGCCGTACTCGAACATTCAAGCTAATTCTCACCTACTGCATGTGGTTCAGCCTACAG
AATTGCCAAGAAGTGATCGAGAGATGCCCATTAAGGAGTCACCGACACGACCTGCCACTGCTAGTGAAGTACGTGGAGCTGTGTTGACATTTTGACCAAA
CAAAACTGACCAACACTTCTGAAATCATGAAGATTCTAGACACCAGGTATCCAGGTTATCAGGGCAATGTACGAGGCTACGTCAGGTACGAAGGAATGCT
GCTACTGACCGCAACCGACGACAACTCATCGCGTCTCTGCTCTAGGAGGTCGCCTGAAGTGCTATCGACCTCGTTAGATCCATCCAATACTGTAAGTAAG
CGTCATTGATTCATTTGCATGTAGCAGGCCCATAACGATTAAGTATTTCATGGACAATCAGGCACATGGGTGGCATCGTCACTCGTATTCGCTCCAAACT
GGCACTGCTGATCCTGGTGGTCGGTATAGGACCCGGACAGAGTCAATGGTAGCTAATGACATGAAGTATACTGGTGCGGGAGAGCTCCCCGTAAATGCTC
CCAACCAAGAGGTACGCAGAGAAGGAGGATTCTTCTACAATAGCAAATGGTATGGCCGCTGACCTGACGAAGGATAGGTGCACTTTGCAGTGACTGAGGA
GATCCCAGGAGTCCCGATCGTCTATCGGAATCAAAAGGTAAGGCTGTCAAGTGCTCTCTCGCATGCGTTTCTAAAAACATGTTATGATCTGCTGCATATT
AGACAAAAGTATCGAACCCCGAGCGACTAAATCTCGATCGTCGCAACCTGCCAGTGATTCCTCTTCTTGAAGGTGAGCAGATTCTTCGCCTTCTCAATCT
TCAAAATAATGTCATCCGGAGGATAGAGAATCTACTGGGACTGCCGAATCTAATTTTCCTCGACCTCTACAATAATCGCATCGAGGTACGTGGTGTAGCA
CTTTTTGTCTCGGTCACTTGTCAACTTGATGACTTATTCTTCGTGAAGAAACTTGAGAATTTACACTTGGTGCCCAACCTACGAGTGCTTATGATGGGGA
AGAATCGACTTCGTACCATTGAGAATCTAGACTGCTTGAAAAAACTGGACGTGCTGGATCTACACAGGTACGTTGATGTCAACCTAAAAAGTGGGCGTTT
TCGACTAAATCTCTGGTCCTGAAGCAACGAAATTGAGCAGATGCAGAACCTGAACGAGCTCAAAGAGCTGCGTGTCTTAAATCTGGGTGGGAATATGATC
TCCGCAGTTGAAAACATTGACAAGTTGATGCTCCTCACCGAGCTGAATCTCCGACGAAATCGAATCCGTCGCATCGGAGCAATTGGCACTCTGCCGTCAC
TTCTAAGACTTTTCTTGTCCAACAACAAGCTCGAGACATTCGAGTCGATAGCACCACTATTTCAGGTACGTGGATCAATCATGTCAACTGTCGATAGACA
CAGCAGCTAACAAAAGTGGCTGCGGGAGCTGCAGGTCTCGTCCATCAGCGAGTTGCGCTTGGACTCGAATGGAGTCTGCGCTCCTGACCAGATGGAGTAT
CGTGTGCGTATGATAAACAGCTTCCCGTCACTGAAGCATCTGGACCTCAAGCCTCTAAGTGATGCTGATAGAAAAGAAGCGTTGCTACGTGCCAATTCCC
CCAGCAAAAGCGTTGATACAGCGGAAGCGGCTGCAAGAGTGCAAGCGATTTCATGCGTCAAGGCGAACTGGGAACGGCGTTCTCCAGTGAGTAGCGAAGA
CTCGCGAGATTCGTCGTTTGTTTCGTCTTGGGAGCTCTCTACCAAAGCCGAGTTGAGTTCTCATGGCGGGTATGAAGAACGAGCGAGCACACCGATACAT
CGGGAGGAATCAACCGTGTACAGCAACAACGCGGGCTTTTCTGAGCTTGAGGTCTACGGTGACTACCGTGTTCTTGTCATCTATGGTGACGCGCTAGACG
CCCTCGAGCAGACCAAAGCTCACGCGTTGGTAAACGCAATTTCGTTTCGCTATTTGGGTATTGCCAAGATCGTGGCTGCTGTCAGTAGCGCTACAAACGC
CAATCTCAAGCTGTTTACAAGATTGAGGAGATTTTTTTTCGCGTACAACGATCTCCAGTCGTTCGATGAGCTGTTGTGGCTGAATACTATGGGGTTGAAA
GCTGAAGAGGTTGATGCTAATCAGGGTGTGTAGCCTACTGCTTCGAGTGCTAATTGTGTGACGCTGTGGGTTTCCAGGTATACATTTCCCAGAATCCTGT
CTGTGCCAAGACTCTTCTCAAGAGATTCATCGGTGCTCGAATCAGTGTGCGTTCGTTATGTGCTTCTTTGGTGTGGCACCTCCCTCAGCTTATCTATTGA
TGTGTGTGTGTCCTCCGGTAGAATATATTGCGCCTCAACGGCGAAGAGATCAACTCAATCGACAGACATATGGGCAAGCAGCTCTTCCCAAAGCCCAGTG
TCCCCCGTACGCGAGCAGTAGACGCTCCAGAGCTTCACCCATTGCTGCCCTCAAAGGCTCGTGTGAAAGAGGGCAGGGACGCGAAAGTGCCCCGATCATT
GTCAGTTCTGCACAGTTCTGCCACACCCTCCGCAGTCACCGAGATATTCGACGCAGCATCCGACATCGAAATGAAGTCCACGGTATGTCATGTGCTTGTC
GTCCTGTCCAGTCTCCGGTCACCTCACTGCTCTAACTGATGTACCGGTAGGCGCTAGACCAAGCGTGGAAGGACATGCTCTTGACAATCGTCAAGGTACG
AGCTTTCCTCTCATCACTATGGACGTGCTTTAACAAACCGCTGTCGTCTATAGGAAACGCTACAAGACATTGAGCGCCGCGACAGCTTCATGTCCGGTTG
TCTCGACAATCTGTAGCCATTATTCAAGGCCAGCACCAGTTTTGAAGTCAAGAGCAAAATACAATATCGAACCGCCAGACATCTATTCCTCCGTGTCAGC
TTTGTCCGCCTTCTTGCTCTTCTTCTTGTCCTCCTTGTCCACGTCCATCTCGCCGCGTACCTCCTTCTCCATCTGACGGATACGCATCCGTCGCAGCACC
TTGTTCGAGACCTTCTTCACCACTGTTTTGCTCTCCTTTTGAGCTTTCTGTAGTCGTTAGCAACACATTGTTTAAAAAAACTGACCTGGTTTCTTCAACT
GCACACAATGCCACGTACCCTCTCGCGCTTCTTCATGAGTTTCTCTTTGCGTAGTCGCTCTTTTTCGACTTCCAGCTCATACTGGGCCTTGATCTTGTTA
CGGTTGTTCTTCCTGGACATGGCTGTGCTCTTCGCTCACCCTACAGACGGCAACAATGATGTGCAAGTACTGACCCTGTGTCGCTTGAGACCACCGACTA
TTGCACCACACCATATGTACGCAAAGTTTGTGCATTTTCCGCCAATCCTGATAAGACTCAGTTTTGCATGAGTGGATCCACCAGGAAGCTTATCAATTGT
GCGGCGGAGAGCTATGAAGGGCCGACGCCAGCGCGCCCAGACGCGATCTGTGTACAGCATGCTACCTGCTAGCATCCGGTATGTTCGCCTAGTCGTCGTA
GAATGATAAGAGATGAGTTCTACGCCTGTATATTTGTTGTGGTATCCGTATTTACGAGTGGACTCATGGTGGACAACCAGGCGGACGCTGGCAGGTGTAT
CACTTGGCATCTCCATTGGCGTCGCAGGGACTTTGATACTGCTAAGAGTTGAAGAGGAAACCGAGAAACCAAGTCGACGCGTCCCAATTCCGACCGATCG
CAAGCCATTCGATCCTAAAACGCTACCCAAGCATGAAGCACTTCGCTACGGAATGCCCTCCGACTCGAATGTGCATGTGCGGTCGGGATACGTCGTGTCG
TACGACTATCGGTGCGTGCATTGAGTGCATATGTAGTGTTTAGTGGATAATCTGACGGGTTTTATGTTTTTGCTCTGTCAGCACGCGTAATGCGTCGTGG
GTGATGGAATACTTGACGAAAGACTCGCTGCGAGTTGAGCAAGAGACGGATCGAGCGAATTCCAAGTTTGTTGTCGATAAAGATGTTCCAGAACAGTTTA
GGGTGCACCCGAATCGGTATCTTAAGAGCGGCTATGACAAGGGCCACCTCGCTCCAGCTCGTAAGTTCTCCCCCTTATCCCATCAAGAAAAGTTTTAATC
CCTGCTCATTCCTTATGCCGTTGATGGAATGCAGGTAACATGAGTCACTCCCAGGAAGCCATGGACGATAGCTTTCTAATGACCAACATGTCGCCGCAAG
TCGGTGTTGGCTTCAACCGTGGCTATTGGTCACGTCTTGAGGGCTTCATGCGTCATCTAGCTGGACAATACGACGCACTTTACGT